Results 1 to 2 of 2

Thread: Y-chromosome haplotype strata in Anatolia ( full Article)

  1. #1
    Member
    Join Date
    Aug 2007
    Last Online
    Saturday, April 28th, 2018 @ 05:23 AM
    Ethnicity
    Katarinensische
    Subrace
    Dinarid
    Gender
    Age
    42
    Family
    Single adult
    Posts
    1,243
    Thanks Thanks Given 
    0
    Thanks Thanks Received 
    1
    Thanked in
    1 Post

    Post Y-chromosome haplotype strata in Anatolia ( full Article)

    Human Genetics
    Publisher: Springer-Verlag Heidelberg
    ISSN: 0340-6717
    DOI: 10.1007/s00439-003-1031-4
    Issue: Volume 114, Number 2

    Date: January 2004
    Pages: 127 - 148
    Original Investigation
    Excavating Y-chromosome haplotype strata in Anatolia
    Cengiz Cinniolu1, 4, Roy King2, Toomas Kivisild3, Ersi Kalfolu4, Sevil Atasoy4, Gianpiero L. Cavalleri1, Anita S. Lillie1, Charles C. Roseman5, Alice A. Lin1, Kristina Prince1, Peter J. Oefner6, Peidong Shen6, Ornella Semino7, L. Luca Cavalli-Sforza1 and Peter A. Underhill1

    (1) Department of Genetics, Stanford University School of Medicine, 300 Pasteur Drive, Stanford, CA 94305-5120, USA
    (2) Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California, USA
    (3) Estonian Biocentre and Tartu University, Tartu, Estonia
    (4) Institute of Forensic Sciences, Istanbul University, Istanbul, Turkey
    (5) Anthropological Sciences, Stanford University, Stanford, California, USA
    (6) Stanford Genome Technology Center, Palo Alto, California, USA
    (7) Dipartimento di Genetica e Microbiologia, Università di Pavia, Pavia, Italy

    Received: 13 June 2003 Accepted: 19 August 2003 Published online: 29 October 2003

    Abstract Analysis of 89 biallelic polymorphisms in 523 Turkish Y chromosomes revealed 52 distinct haplotypes with considerable haplogroup substructure, as exemplified by their respective levels of accumulated diversity at ten short tandem repeat (STR) loci. The major components (haplogroups E3b, G, J, I, L, N, K2, and R1; 94.1%) are shared with European and neighboring Near Eastern populations and contrast with only a minor share of haplogroups related to Central Asian (C, Q and O; 3.4%), Indian (H, R2; 1.5%) and African (A, E3*, E3a; 1%) affinity. The expansion times for 20 haplogroup assemblages was estimated from associated STR diversity. This comprehensive characterization of Y-chromosome heritage addresses many multifaceted aspects of Anatolian prehistory, including: (1) the most frequent haplogroup, J, splits into two sub-clades, one of which (J2) shows decreasing variances with increasing latitude, compatible with a northward expansion; (2) haplogroups G1 and L show affinities with south Caucasus populations in their geographic distribution as well as STR motifs; (3) frequency of haplogroup I, which originated in Europe, declines with increasing longitude, indicating gene flow arriving from Europe; (4) conversely, haplogroup G2 radiates towards Europe; (5) haplogroup E3b3 displays a latitudinal correlation with decreasing frequency northward; (6) haplogroup R1b3 emanates from Turkey towards Southeast Europe and Caucasia and; (7) high resolution SNP analysis provides evidence of a detectable yet weak signal (<9%) of recent paternal gene flow from Central Asia. The variety of Turkish haplotypes is witness to Turkey being both an important source and recipient of gene flow.




    ---------------------------------

    Human Genetics

    © Springer-Verlag 2003
    10.1007/s00439-003-1031-4

    Original Investigation
    Excavating Y-chromosome haplotype strata in Anatolia
    Cengiz Cinniolu1, 4, Roy King2, Toomas Kivisild3, Ersi Kalfolu4, Sevil Atasoy4, Gianpiero L. Cavalleri1, Anita S. Lillie1, Charles C. Roseman5, Alice A. Lin1, Kristina Prince1, Peter J. Oefner6, Peidong Shen6, Ornella Semino7, L. Luca Cavalli-Sforza1 and Peter A. Underhill1

    (1) Department of Genetics, Stanford University School of Medicine, 300 Pasteur Drive, Stanford, CA 94305-5120, USA
    (2) Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California, USA
    (3) Estonian Biocentre and Tartu University, Tartu, Estonia
    (4) Institute of Forensic Sciences, Istanbul University, Istanbul, Turkey
    (5) Anthropological Sciences, Stanford University, Stanford, California, USA
    (6) Stanford Genome Technology Center, Palo Alto, California, USA
    (7) Dipartimento di Genetica e Microbiologia, Università di Pavia, Pavia, Italy


    Peter A. Underhill
    Email: under@stanford.edu
    Phone: +1-650-7235805
    Fax: +1-650-7251534

    Received: 13 June 2003 Accepted: 19 August 2003 Published online: 29 October 2003

    Abstract Analysis of 89 biallelic polymorphisms in 523 Turkish Y chromosomes revealed 52 distinct haplotypes with considerable haplogroup substructure, as exemplified by their respective levels of accumulated diversity at ten short tandem repeat (STR) loci. The major components (haplogroups E3b, G, J, I, L, N, K2, and R1; 94.1%) are shared with European and neighboring Near Eastern populations and contrast with only a minor share of haplogroups related to Central Asian (C, Q and O; 3.4%), Indian (H, R2; 1.5%) and African (A, E3*, E3a; 1%) affinity. The expansion times for 20 haplogroup assemblages was estimated from associated STR diversity. This comprehensive characterization of Y-chromosome heritage addresses many multifaceted aspects of Anatolian prehistory, including: (1) the most frequent haplogroup, J, splits into two sub-clades, one of which (J2) shows decreasing variances with increasing latitude, compatible with a northward expansion; (2) haplogroups G1 and L show affinities with south Caucasus populations in their geographic distribution as well as STR motifs; (3) frequency of haplogroup I, which originated in Europe, declines with increasing longitude, indicating gene flow arriving from Europe; (4) conversely, haplogroup G2 radiates towards Europe; (5) haplogroup E3b3 displays a latitudinal correlation with decreasing frequency northward; (6) haplogroup R1b3 emanates from Turkey towards Southeast Europe and Caucasia and; (7) high resolution SNP analysis provides evidence of a detectable yet weak signal (<9%) of recent paternal gene flow from Central Asia. The variety of Turkish haplotypes is witness to Turkey being both an important source and recipient of gene flow.

    --------------------------------------------------------------------------------

    Introduction
    The Anatolian Peninsula (Asia Minor) provides an important geographic link between the Middle East, Asia and Europe. Accordingly, this region manifests an elaborate genetic constitution reflecting the consequences of numerous gene flow, admixture and local differentiation processes spanning from the late Pleistocene to the present day (Cavalli-Sforza et al. 1994). Both environmental and cultural influences associated with the spread of the Upper Paleolithic industries (Kuhn 2002), the Last Glacial Maximum (LGM) and Holocene warming since the Younger Dryas cold reversal, as well as the introduction of agriculture and succeeding Bronze Age, Greek, and Roman presence, may have left detectable traces in the gene pool. In addition, resettlements from Central Asia (Richards et al. 2000), as well as movements during the Ottoman Empire, including recent exchanges of numerous Greek and Turk residents based upon religious affiliation during the 1920s, would add further potential complexity to the phylogeography patterns in Anatolia. The question that we ask in this paper: is it possible to attribute any elements of the amalgamated Anatolian genetic composition to any relatively ancient and recent chronologies/populations? While most human genetic diversity is affected by recombination, the low effective population size of clonal Y-chromosome segments (Shen et al. 2000) enhances them with greater sensitivity to detect incidents in the demographic histories of the populations that may otherwise leave little imprint on the autosomal elements of the gene pool. The resulting often non-random correlations between binary marker defined haplogroups with geography (Underhill et al. 2001) and corresponding short tandem repeat (STR) variance (de Knijff 2000) provide a genetic metric with which to sieve through complex deposits of human history on both micro-geographic and temporal scales. To begin to better understand how the succession and magnitude of events spanning millennia have contributed to the current genetic composition of Turkey, we have assessed patterns of Y-chromosome diversity distributed across Turkey plus Istanbul. The data illuminate numerous long-standing themes, including the Holocene expansions, contributions of agriculturalists to the European gene pool and genetic assessment of Caucasian and Central Asian gene flows.


    --------------------------------------------------------------------------------

    Materials and methods
    Samples
    A total of 523 samples distributed amongst 90 cities, plus Istanbul, were studied. With the exception of 79 samples from cosmopolitan Istanbul, all remaining 444 samples were assigned to regions commonly distinguished by climate and rainfall (Fig. 1), as based upon stated paternal residential heritage obtained during the informed consent process. The coordinates for each of the nine regions were determined by averaging the latitude and longitude of each regional city, weighted by the number of samples in each city. The respective latitude (N) and longitude (E) by region are: (1) 40.9, 28.1; (2) 41.5, 33.7; (3) 40.8, 38.6; (4) 39.2, 40.7; (5) 37.5, 39.1; (6) 36.7, 34.5; (7) 39.3, 34.7; (8) 38.3, 28.6; (9) 41.0, 29.1. In order to test a hypothesis of Bronze Age gene flow from the Caucasus, a different geographic definition was employed. Specifically we divided the Anatolian peninsula into two sections bounded by a curve containing cities within 50 km of the Kzlrmak River and east Pontic region 3 (Fig. 1). This region comprises the historically attested Bronze Age Hattic and Kaska cultural horizons. A 2 test was used to compare the frequencies of haplotypes across the two archeological regions. On the basis of the known high frequency of G-M201 in populations from the Caucasus (Semino et al. 2000a; Nasidze et al. 2003), an a priori hypothesis was tested comparing G-M201 frequencies of the Hattic-Kaska delineated zone to that outside the region. A total of 359 samples were from blood banks, 61 from paternity clinics and 103 from staff and students enrolled at Istanbul University. DNA was isolated from blood drawn leucocytes using Qiagen reagents and protocols.

    Fig. 1 Map of sample locations. City name codes by region are: 1.01 Akyaz, 1.02 Babaeski, 1.03 Bilecik, 1.04 Bursa, 1.05 Çanakkale, 1.06 Edirne, 1.07 Erdek, 1.08 Izmit, 1.09 Krklareli, 1.10 Sakarya, 1.11 Saray, 1.12 Sumnu, 1.13 Tekirda, 1.14 Yalova; 2.01 Bartn, 2.02 Düzce, 2.03 Gerze, 2.04 Karabük, 2.05 Kastamonu, 2.06 Safranbolu, 2.07 Sinop, 2.08 Uzunta, 2.09 Zile, 2.10 Zonguldak; 3.01 Amasya, 3.02 Artvin, 3.03 Bafra, 3.04 Bayburt, 3.05 Giresun, 3.06 Gümühane, 3.07 Mesudiye, 3.08 Ordu, 3.09 Perembe, 3.10 Rize, 3.11 Samsun, 3.12 Sürmene, 3.13 Tokat, 3.14 Trabzon; 4.01 Ar, 4.02 Ardahan, 4.03 Bingöl, 4.04 Bitlis, 4.05 Doubeyazt, 4.06 Elaz, 4.07 Erzincan, 4.08 Erzurum, 4.09 Idr, 4.10 Kars, 4.11 Malatya, 4.12 Mu, 4.13 Pervari, 4.14 Sarkam, 4.15 Tunceli, 4.16 Van; 5.01 Adyaman, 5.02 Diyarbakr, 5.03 Gaziantep, 5.04 Kilis, 5.05 Mardin, 5.06 Siirt 5.07 Urfa; 6.01 Adana, 6.02 Antakya, 6.03 Antalya, 6.04 Burdur, 6.05 Iskenderun, 6.06 Isparta, 6.07 Mersin, 6.08 Samanda, 6.09 Tarsus; 7.01 Ankara, 7.02 Çankr, 7.03 Çorum, 7.04 Ereli, 7.05 Eskiehir, 7.06 Karaman, 7.07 Kayseri, 7.08 Krkkale, 7.09 Krehir, 7.10 Konya, 7.11 Nevehir, 7.12 Nide, 7.13 Sivas, 7.14 Ürgüp, 7.15 Yozgat; 8.01 Afyon, 8.02 Aydn, 8.03 Denizli, 8.04 Izmir, 8.05 Manisa, 8.06 Mula, 8.07 Sandkl, 8.08 Simav, 8.09 Uak; 9.01 Istanbul

    --------------------------------------------------------------------------------

    Polymorphisms and haplotyping
    Most polymorphisms have been previously reported (Underhill et al. 2001; Y Chromosome Consortium 2002). Details for new informative markers are summarized in Table 1. Genotyping was done using DHPLC methodology (Oefner et al. 1998), following a phylogenetic hierarchical approach. Lineages are referred to in the text by haplogroup and terminal mutation according to standardized nomenclature (Jobling et al. 2003). All 523 samples were also analyzed at ten STR loci: DYS19, DYS388, DYS390, DYS391, DYS392, DYS393, DYS389I, DYS389II (Kayser et al. 1997), DYS439 (Ayub at al. 2000) and DYSA7.2 (also called DYS461) (White et al. 1999) using 5-labeled fluorescent primers, an ABI 3100 capillary sequencer, internal size standards and GeneScan fragment analysis software. Conversion of absolute fragment size to number of allele repeats was achieved using results obtained from sequencing both strands of control samples independently amplified with unlabeled primers. Sequencing of DYS389 is complicated since the standard genotyping primers amplify two fragments (Rolf et al. 1998). Calibration of DYS389 in control DNA was achieved by using ABCDE 5-ccatcgacctatctgtctctattata-3 and conventional reverse primers (Kayser et al. 1997) to amplify a single approximately 518-bp fragment encompassing five tetranucleotide motifs. Subsequent sequencing using the same amplification primers allowed precise determination of the allele repeat counts for the four traditionally reported variable tetranucleotide regions (ABCD). The DYS389II (AB fragment) repeat allele number was determined by subtracting the DYS389I (CD fragment) repeat number (Cooper et al. 1996).
    Table 1 Description of Y-chromosome binary polymorphisms
    Marker no.
    Nucleotide change
    Position (bp)
    Forward 53
    Reverse 53
    Total size (bp)

    M231
    G to A
    110
    cctattatcctggaaaatgtgg
    attccgattcctagtcacttgg
    331

    M241
    G to A
    54
    aactcttgataaaccgtgctg
    tccaatctcaattcatgcctc
    366

    M242
    C to T
    180
    aactcttgataaaccgtgctg
    tccaatctcaattcatgcctc
    366

    M253
    C to T
    283
    gcaacaatgagggtttttttg
    cagctccacctctatgcagttt
    400

    M267
    T to G
    148
    ttatcctgagccgttgtccctg
    tgtagagacacggttgtaccct
    287

    M285
    G to C
    70
    ttatcctgagccgttgtccctg
    tgtagagacacggttgtaccct
    287

    M286
    G to A
    129
    ttatcctgagccgttgtccctg
    tgtagagacacggttgtaccct
    287

    M287
    A to T
    100
    ttatcctgagccgttgtccctg
    tgtagagacacggttgtaccct
    287

    M304
    A to C
    421
    caaagtgctgggattacagg
    cttctagcttcatctgcattgt
    527

    M335
    T to A
    162
    aagaaatgttgaactgaaagttgat
    aggtgtatctggcatccgtta
    417

    M339
    T to G
    285
    aggcaggacaactgagagca
    tgcttgatcctgggaagt
    517

    M340
    G to C
    218
    ccagtcagcagtacaaaagttg
    gcatttctttgattatagaagcaa
    386

    M342
    C to T
    52
    agagagttttctaacagggcg
    tgggaatcacttttgcaact
    173

    M343
    C to A
    402
    tttaacctcctccagctctgca
    acccccacatatctccagg
    424

    M349
    G to T
    209
    tgggattaaaggtgctcatg
    caaaattggtaagccattagct
    493

    M359
    T to C
    122
    cgtctatggccttgaaga
    tccgaaaatgcagacttt
    447

    M365
    A to G
    246
    ccttcatttaggctgtagctgc
    tgtatctttagttgagatgg
    274

    M367
    A to G
    196
    ccttcatttaggctgtagctgc
    tgtatctttagttgagatgg
    274

    M368
    A to C
    200
    ccttcatttaggctgtagctgc
    tgtatctttagttgagatgg
    274

    M369
    G to C
    45
    ccttcatttaggctgtagctgc
    tgtatctttagttgagatgg
    274

    M370
    C to G
    166
    ccttcatttaggctgtagctgc
    tgtatctttagttgagatgg
    274


    Haplogroup diversity
    STR variance, averaged over ten loci on binary haplotype backgrounds with sample sizes 7, was used to assess the relative level of diversity and phylogenetic substructure with geography. The F tests, based upon the ratio of 2 distributions of average variances, were used to evaluate comparisons of average variances amongst geographic regions. STR data were also used to estimate haplogroup specific expansion times by two methods. Both approaches assume a stepwise mutation model, an average evolutionary STR mutation rate of 0.0007 per STR locus per generation (Zhivotovsky et al. 2003), whose value is based upon a generation time of 25 years. One method assumes a star-like genealogy characteristic of continuous population growth in which the variance is equal to the mutation rate per generation time the number of generations since expansion (Di Rienzo et al. 1994; Kittles et al. 1998). The other method employs a Bayesian algorithm. To estimate the time of Anatolian population expansions, we used the Markov chain Monte Carlo (MCMC) approach (Wilson et al. 1998) incorporated into the program BATWING to estimate posterior distributions for parameters of a given model of population history.

    We considered a model of exponential growth from initial constant population size beginning at time Beta, with an effective population size prior distribution specified as a gamma (1, 0.0001) as used by Weale et al. (2001). The prior distribution for the STR mutation rate was specified as a gamma distribution with a mean of 7×10–4 per locus per generation and the prior distribution of the growth rate were assigned a gamma (1, 0.001). The prior distribution for Beta was assigned a broad uniform prior (0, 15). Priors were specifically chosen to be as uninformative as possible so as to minimally impact the results. We calculated the mean, median, and 2.5 and 97.5% quantiles for the posterior distributions for Beta, the estimated time of population expansion. Beta is expressed as a fraction of the initial population size multiplied here by generation time to yield values standard units of time. Calculations were based on 50,000 runs of MCMC estimator after a 20,000 run burn in time.


    --------------------------------------------------------------------------------

    Results
    A total of 69 out of 89 binary polymorphisms genotyped were informative and defined 52 distinct haplotypes. Their phylogenetic relationships and frequency distribution by geographic region are shown in Fig. 2. While none of the major haplogroups (E, G, J, R) showed significant micro-geographic structure, additional binary and STR haplotype resolution analysis revealed some distinct phylogeographic patterns. All STR data arranged by corresponding binary composition are given in Appendix table A.

    Fig. 2 Phylogenetic relationships, nomenclature and haplogroup frequencies. The 65 informative markers that were haplotyped are indicated in dark font and the remaining five markers shown in italics included to provide phylogenetic context. The following 19 polymorphisms were also genotyped but not observed: M3, M18, M26, M27, M33, M37, M38, M60, M62, M68, M75, M132, M137, M163, M166, M174, M181, M210, M222

    --------------------------------------------------------------------------------

    Y chromosome haplogroups and associated diversity
    Haplogroup J is defined by the overarching DYS11/12f2 human endogenous retroviral polymorphism (Sun et al. 2000; Rosser et al. 2000). This polymorphism is widely distributed in Eurasia, Middle East and in North Africa (Hammer et al. 2001; Quintana-Murci et al. 2001). Although this polymorphism is recurrent (Blanco et al. 2000), occurring independently on certain D and F haplogroup lineages (Y Chromosome Consortium 2002), its association with the additional M304 transversion helps now to define the J clade with less ambiguity. The J clade was preeminent in all nine regions with an average frequency of 33%. Only one sample, with an atypical DYS388 12 repeat allele (see Appendix table A), resolved to J-M304*. All other J lineages could be assigned to two sub-clades, J1 and J2 defined by transversion mutations M267 and M172, respectively. Four new markers, M365, M367, M368 and M369 were detected on haplogroup J1-M267 samples, each associated with single representative. In contrast, haplogroup J2-M172 fractionates into nine discrete lineages, three of which — defined by M12, M47 and M67 — display informative frequency, making them useful for detecting phylogeographic patterns. Grouping all sub-lineages, the J2 frequency (24%) is evenly distributed over Turkey (2=7.17, df=8, P=0.52), yet the relatively high J2 related STR variance (Table 2) shows a significant decline with increasing latitude (r=–0.87, P<0.002, Spearman).
    Table 2 Y-chromosome haplogroup variance and expansion times based on ten STR loci
    Haplogroup
    n
    Variance
    T (kyr)a
    Beta and percent quantiles (kyr)b
    Initial effective population

    Mean
    Median
    2.5%
    97.5%
    size per 1,000 individuals

    E3b1-M78
    26
    0.18
    6.4
    8.0
    4.8
    0.8
    50.7
    0.161 (0.045–0.630)

    E3b3-M123
    29
    0.51
    18.2
    44.6
    3.7
    0.1
    991.5
    1.489 (0.140–0.569)

    G-M201
    57
    0.40
    14.3
    44.6
    20.3
    0.3
    489.6
    0.161 (0.032–1.353)

    G2-P15
    50
    0.35
    12.5
    31.0
    15.5
    0.4
    372.6
    0.780 (0.035–1.112)

    G-M201(xP15)
    7
    0.42
    15.0
    36.0
    10.4
    0.1
    891.4
    0.570 (0.061–3.317)

    I-M170
    28
    0.50
    17.9
    13.4
    8.0
    0.1
    79.0
    1.340 (0.543–6.669)

    I-M170(xP37)
    15
    0.40
    14.3
    19.6
    5.8
    0.1
    126.4
    1.366 (0.198–3.764)

    I1b-P37
    13
    0.23
    8.2
    19.1
    9.1
    0.9
    101.2
    0.183 (0.015–0.286)

    J-M304
    175
    0.56
    20.0
    36.1
    13.9
    0.2
    473.2
    0.184 (0.036–1.306)

    J1-M267
    47
    0.51
    18.2
    39.6
    15.4
    0.4
    604.8
    0.366 (0.061–1.895)

    J1-M267, long DYS388 alleles
    39
    0.39
    13.9
    31.9
    18.9
    0.5
    273.9
    0.113 (0.030–0.751)

    J1-M267, short DYS388 allele
    8
    0.25
    8.9
    14.3
    1.4
    0.0
    512.4
    0.385 (0.045–2.041)

    J2-M172
    127
    0.52
    18.6
    17.9
    14.5
    2.0
    78.5
    0.821 (0.281–2.575)

    J2-M172*
    75
    0.47
    16.8
    36.1
    16.9
    0.6
    471.8
    0.349 (0.051–1.514)

    J2f-M67
    33
    0.33
    11.8
    16.4
    12.5
    1.7
    92.0
    0.285 (0.850–1.076)

    J2e-M12
    9
    0.24
    8.6
    12.5
    4.0
    0.0
    306.6
    0.334 (0.052–1.833)

    K2-M70
    13
    0.36
    12.9
    39.4
    9.0
    0.0
    1,093.4
    0.647 (0.063–3.889)

    L-M11
    22
    0.41
    14.6
    26.3
    2.4
    0.0
    1,044.8
    1.386 (0.150–5.181)

    N-M231
    20
    0.28
    10.0
    20.6
    6.9
    0.2
    326.0
    0.176 (0.023–1.062)

    Q-M242
    10
    0.46
    16.4
    23.3
    10.7
    0.1
    289.4
    0.600 (0.120–3.550)

    R-M207
    126
    0.65
    23.2
    15.3
    13.1
    2.7
    63.4
    0.889 (0.369–2.452)

    R1b3-M269
    76
    0.33
    11.8
    23.4
    17.5
    1.9
    127.7
    0.085 (0.029–0.349)

    R1a1-M17
    36
    0.25
    8.9
    4.9
    4.1
    0.8
    23.2
    0.896 (0.342–2.947)


    aContinuous growth
    bBayesian exponential growth, posterior probabilities are shown
    The J2f-M67 lineages which occur at 6.3% frequency overall, show a significantly negative correlation with distance from region 1 in the northwest (Table 3). Moreover, regions 1, 7, 8, and 9 that clustered together in STR-based two-dimensional principal components analysis (not shown) displayed on average significantly higher (P<0.011) frequency of J2f-M67 than other regions.
    Table 3 Correlations of Y-chromosome haplogroup frequencies with geography
    Haplogroup
    n
    Spearmans correlation coefficient

    Latitude
    Longitude
    Distance from region 1

    E3b1-M78
    26
    0.430
    –0.430
    –0.420

    E3b3-M123
    29
    –0.717**
    0.633
    0.633

    G-M201
    57
    –0.367
    0.250
    0.333

    G-P15
    50
    –0.333
    0.100
    0.150

    I-M170
    28
    0.550
    –0.817
    –0.850*

    J1-M267
    47
    0.133
    –0.067
    –0.050

    J2-M172
    128
    0.267
    –0.033
    –0.133

    J2f-M67
    33
    0.667**
    –0.600
    –0.733**

    L-M11
    22
    0.289
    0.119
    0.017

    N-M231
    20
    –0.418
    0.042
    0.092

    R1a1-M17
    36
    –0.600
    0.680**
    0.650

    R1b3-M269
    76
    –0.183
    –0.183
    –0.100


    *P<0.01 Spearman, n=9, two tailed; **P<0.05 Spearman, n=9, two tailed
    Haplogroup J1-M267 occurs at 9% frequency and is also uniformly distributed across Turkey (2=9.02, df=8, P=0.34), with the exception of eight samples localized to the northern geographic periphery that all have an unusual short 13 repeat DYS388 allele, that was confirmed by sequencing. No DYS388 intermediate size 14 tandem repeat alleles were detected in any of our J1 samples. We propose that this subset of J1 lineages have a unique heritage since, besides the suggestive micro-geography, the occurrence of a short DYS388 allele on a J background is symptomatic of a deviation of the stepwise mutational process, as already proposed for this locus in a different allelic context (Nebel et al. 2001a).

    The G-M201 haplogroup occurs at (57/523) 10.9% frequency and 0.40 mean STR variance consistent with its early presence in Anatolia. One major clade, G2-P15 and two less frequent sub-clades, G1-M285 and G3-M287, account for all the variation observed except for one individual from Kars region 4 who was left unresolved to the G-M201* level. The totality of G lineages do not show micro-geographic structure on the basis of the criteria used to describe the nine geographic regions (2=9.21, df=8, P=0.33), but they do significantly correlate (2=4.11, P<0.043) when evaluated on the basis of the archeological boundaries of the Bronze Age Hattic and Kaska cultures (Fig. 1). In addition, variances of G2-P15 lineages are correlated with longitude (r=–0.72, P<0.03, n=9) showing higher variances towards western Anatolia. The distinctive G1-M285 lineages are restricted to region 3.

    Haplogroup I-M170 is a major lineage cluster largely restricted to populations of Europe (Semino et al. 2000a). Despite its relatively low average frequency (5.3%) in Turkey five major sub-clades were detected. The I-M170 chromosomes are more localized towards the west and show a significant correlation (r=–0.82) with longitude and geographic distance from region 1 (r=–0.85), the European pole of Turkey (Table 3). While haplogroup I-M170 displays overall with high STR variance (Table 2) the I1-P37 sub-clade accounts for almost one half of the lineages overall, but it shows significantly lower variance relative to other I lineages (Table 2).

    Haplogroup E3b-M35 occurs at an overall 10. 7% frequency with E3b1-M78 and E3b3-M123 accounting for all E representatives except a single E3b2-M81 chromosome. Although E3b1-M78 and E3b3-M123 occur at similar frequencies (5.0% and 5.5%, respectively) their associated mean STR variances (Table 2) are significantly different [F (280,250) = 2.83, P<0.01]. The more diverse Turkish E3b3-M123 lineages are correlated with latitude (Table 3).

    Haplogroup R-M207 lineages occur at 24.1 frequency on the whole with the majority belonging to the R1-M173 sub-clade (Fig. 2). Only one R1-M173* lineage was observed in eastern region 5. All but one (R1c-M343) of the remaining R1-M173 associated lineages allocate to R1a1-M17 and R1b-P25 sub-clades with R1b3-M269 being preponderate at 14.5% overall in Turkey. Although R1b3-M269 lineages are found throughout Europe at considerable frequency (Cruciani et al. 2002), no additional PCR compatible binary markers are currently known that show additional informative subdivision within this clade. However, two TaqI haplotypes ht15 and ht35 associated with the complex RFLP 49a,f locus, are associated with R1b3-M269 lineages. The 49a,f ht15 form is rare in Turkey but common in Iberia (Semino et al. 1996), while 49a,f ht35 representatives are distributed across Europe (Torroni et al. 1990; Santachiara-Benerecetti et al. 1993; Semino et al. 2000b) and occurs at ~10% in the Balkan region (Santachiara-Benerecetti, personal communication). In an attempt to better understand the affinity of the frequent Turkish R1b3-M269 lineages relative to other regions, we have analyzed the same battery of STR loci in 52 additional R1b3-M269 defined samples from Iberia, the Balkans, Iraq, Georgia, and Turkey that were previously determined to be 49a,f ht15 or ht35, as well as an additional 59 European R1b3-M269 derived samples. STR haplotype data for these 111 samples are given in Appendix table B. Principal component analysis of all 187 R1b3-M269 samples at ten STR loci variables reveals distributions coinciding with samples of known 49a,f ht15 and ht35 constitution (Fig. 3). Most of the Turkish samples group with the Balkan and the Caucasian 49a,f ht35 samples, while the West European samples associate with the 49a,f ht15 samples. The variance of 49a,f ht35 related chromosomes are lower in the Balkan, Caucasian and Iraqi representatives than those in Turkey (Table 4). Similarly, the variance is higher in Iberia than in Western Europe. The decreasing diversity radiating from Turkey towards Southeast Europe, Caucasus and Mesopotamia approximates similar results from Iberia tracing the re-colonization of Northwest Europe by hunter-gatherers during the Holocene as suggested by others (Torroni et al. 1998; Semino et al. 2000a; Wilson et al. 2001).

    Fig. 3 Plot of 187 R1b3-M269 derived lineages against values for the initial two principal components for ten microsatellite loci variables. The first component accounts for 19% of the total variance, whereas the second component accounts for 16%. Samples whose p49a,f ht15 (n=13) or ht35 (n=39) status is known are indicated in red and yellow, respectively. Geographic areas include: Iberia (n=27), W. Europe (n=45), Turkey (n=79), Balkans (n=21), Georgia/Iraq (n=15). W. Europe includes France, Italy, Germany, Norway; Balkans includes Albania and Greece. Large symbols represent the means for the eight groups. The one Iberian ht15 outlier reflects the influence of an unusual DYS388 allele. Both M269 and DYS388 results for this sample were confirmed by sequencing

    --------------------------------------------------------------------------------

    Table 4 Variance of R1b3-M269 and TaqI p49a,f Ht15, Ht35 STR haplotypes
    Populationa
    n
    Variance

    Turkey
    79
    0.31

    Iberia
    27
    0.24

    W. Europe
    45
    0.22

    Georgia
    15
    0.22

    Balkan
    21
    0.18

    p49a,f-Ht35
    39
    0.19

    p49a,f-Ht15
    13
    0.18


    aPopulations grouped as given in Fig. 3
    In Turks R1b3-M269 and R1a1-M17 occur at 14.7% and 6.9%, respectively. In addition R1b3-M269 related YSTR variance is significantly higher than that of R1a1-M17 [F (750,350) = 1.32, P<0.01). While no micro-geographic substructure is detected in Turkey for R1b3-M269, the frequency of R1a1-M17 is higher in Eastern Turkey and its distribution significantly correlates with longitude across the nine regions (Table 3). The majority of L-M11 chromosomes occur in the most eastern regions 3 and 4 (2=17.99, df=8, P<0.021) and also have high levels of variance (Table 2).


    --------------------------------------------------------------------------------

    Discussion
    Under an assumption of a negligible role of natural selection on Y-chromosome haplogroup distribution, the assessment of background STR variance can provide insights into haplogroup subdivision, size fluctuation, directionality of distribution and relative chronology amongst haplogroups. The haplogroup-specific variances may reflect potential associations with Upper Paleolithic, Holocene and agriculturalist processes. Although the occurrence of early agriculture in the Near East is almost contemporaneous with the onset Holocene climatic warming, the consequences of growth and migration specifically due to agriculture are likely to be more recent.

    Haplogroup J and the transition to agriculture
    Although the entire J-M304 clade demonstrates a large microsatellite variance that under a continuous growth model dates to around 20 kyr, consistent with the LGM, the BATWING exponential growth model reveals a more recent post-LGM expansion (13.9 kyr). This secondary expansion originates from a low effective population size (n=184) and may indicate that the J clade in Turkey began to participate in demographic expansions during the onset of sedentism in Anatolia and the Levant; e.g., the Natufians (Bar-Yosef 1998). Previously, J clade representatives would have been accumulating STR diversity via genetic drift within various small groups of mobile hunter-gathers during the LGM. We detected a significant reduction of variance of J2-M172 northwards in Turkey This latitudinal trend could be a consequence of an Upper Paleolithic presence of J2-M172 in southern Anatolia and its subsequent spread north and west during the Holocene likely catalyzed by the transition to agriculture (Ammerman and Cavalli-Sforza 1984; Underhill 2002). The northward gradient in J2-M172 variance is consistent with the archeological evidence that agro-pastoral economies of Northwest Anatolia were derived from the Çatal Höyük area in region 7 (Thissen 1999). The presence of J2-M172 related lineages successfully predicted the distribution of both Neolithic figurines and painted pottery attributed to agriculturalists (King and Underhill 2002). The Upper Paleolithic sites in Turkey (Öküzini cave, region 6) have been dated to 17,800 BC and suggest a continuous occupation into the subsequent Neolithic period (Kuhn 2002) while Neolithic sites are considerably fewer in Central and Northern Turkey (Roberts 2002). The J1-M267 and J2-M172 distributions in the Near East and Europe can be inferred from previously reported DYS388 data associated with Eu10 and Eu9, respectively (Semino et al. 2000a; Nebel et al. 2001b; Malaspina et al. 2001; Al-Zahery et al. 2003). While both J1 and J2 are found in the Near East, haplogroup J1-M267 typifies East Africans and Arabian populations, with a decreasing frequency northwards. Alternatively the majority of J lineages in Europe are J2-M172 that radiated from the Levant, coherent with the distributions of mitochondrial J, K, T1 and pre-HV clades (Richards et al. 2002).

    Although we currently lack additional binary polymorphisms capable of defining further informative subdivision within haplogroup J1-M267, the unusual short DYS388 13 repeat allele lineage provides a proxy. These peculiar chromosomes distribute along the northern tier of Turkey. While this lineage has not been observed in Greece, it has been detected in Georgia (Semino, unpublished results), suggesting Black Sea coastal gene flow. A few lineages with potentially similar affinity have been observed scattered throughout the Middle East (Nebel et al. 2001b), although it is not possible to distinguish their affinity to haplogroup J-M304* or J1 since M267 data are unavailable. When the DYS388 short allele representatives are excluded on the assumption that they have a common origin, the residual assemblage of J1-M267 DYS388 long allele lineages contain numerous haplotypes including both the purported Cohen and Arab modal haplotypes (Thomas et al. 2000; Nebel et al. 2002). The similarity of variances associated with the two counterbalancing J1 and J2 sub-clades suggests an enduring common demography. At this level of molecular resolution, the data do not distinguish between agricultural and pastoral domestic livelihoods despite the observation that lifestyle differences exist (Khazanov 1984). Notably, nomads are often more endogamous and participate in transhumant seasonal migrations (Cavalli-Sforza et al. 1994).

    The J2f-M67 clade is localized to Northwest Turkey. It is well known that during this period, Northwest Anatolia developed a complex society that engaged in widespread Aegean trade referred to as Maritime Troia culture, involving both the western Anatolian mainland and several of the large islands in the eastern Aegean, Chios, Lemnos and Lesbos (Korfmann 1996). Another J2 component is intriguing. Although J2e-M12 lineages occur at low frequencies, they are widely distributed in the Middle East (Scozzari et al. 2001) and India (Kivisild et al. 2003), as well as in Saami from Kola, Russia (Raitio et al. 2001). By comparing data sets (Malaspina et al. 2001; Scozzari et al. 2001) we deduced that J2e-M12 lineages are distinctive from all other J2-M172 lineages on the basis of complex DYS413 and YCAII dinucleotide STRs. In corroboration we confirmed by sequencing the simple repeat locus DYSA7.2 that J2e-M12 is exclusively associated with shorter seven- or eight-tetranucleotide repeat alleles in Turkey. The considerable diversification observed in the J clade as exemplified by high variance of J2-M172 and a J-M304* lineage in southeastern Anatolia, is consistent with the early onset of post glacial sedentism found in the archeological record of Anatolia and the Levant (Bar-Yosef 1998).

    G-M201 and post ice-age expansions in Europe
    Although recurrent mutation can occur in the complex 49a,f RFLP polymorphic system the TaqI ht8 restriction profile occurs only within haplogroup J and G lineages (Semino et al. 2000a) suggesting common ancestry. The overlap of J and G lineages with geography bolsters this putative affinity. The apparent scarcity of Upper Paleolithic sites in Anatolia (Kuhn 2002) and the considerable diversification of haplogroup G and J ancestors is consistent with a Upper Paleolithic/Mesolithic Middle East/Mesopotamian origin and the subsequent gradual proliferation of agriculturalists, including their presence (e.g., Çatal Höyük, region 7) during the early Pre-Pottery Neolithic B period (~9,500 BP). Haplogroup G-M201 lineages occur at ~30% in Georgia (Semino et al. 2000a) and the north Caucasus (Nasidze et al. 2003). Haplogroup G-M201 also occurs in Southeast Europe and the Mediterranean (Semino et al. 2000a) and in Iraq (Al-Zahery et al. 2003). In a material context, the Bronze Age Hattic and Kaska cultural region in Anatolia (Fig. 1) has affinity to the Maikop culture of the Caucasus and linguistic affinities to the northwest Caucasian languages (Renfrew 1998). Populations that speak such languages show a high frequency of G-M201 (Nasidze et al. 2003). Haplogroup G2-P15 is the most frequent (9%) G sub-clade in Turkey. G2-P15 lineages have been observed throughout the Middle East with a maximum of 19% in the Druze (Hammer et al. 2000) and an average of 5% in Italy and Greece (Di Giacomo et al. 2003). The expansion time estimates for G2-P15 closely approximate those predicted for R1b3-M269.

    Role of R1b3-M269 in the Aurignacian and Neolithic eras
    Haplogroup R1b3-M269 is one of the most common binary lineages observed in Turkey. The phylogenetic and spatial distribution of its equivalent in Europe (Cruciani et al. 2002), the R1-M173 (xM17) lineage for which considerable data exist (Semino et al. 2000a; Wells et al. 2001; Kivisild et al. 2003) implies that R1b3-M269 was well established throughout Paleolithic Europe, probably arriving from West Asia contemporaneous with Aurignacian culture. Although the phylogeographic pattern of R1b3-M269 lineages in Europe suggest that R1-M173* ancestors first arrived from West Asia during the Upper Paleolithic, we cannot deduce if R1b3-M269 first entered Anatolia via the Bosporus isthmus or from an opposite eastward direction. However, archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau (Kuhn 2002).

    Haplogroup R1b3-M269 occurs at 40–80% frequency in Europe and the associated STR variance suggests that the last ice age modulated R1b3-M269 distribution to refugia in Iberia and Asia Minor from where it subsequently radiated during the Late Upper Paleolithic and Holocene. The R1b3-M269 related, but opposite TaqI p49a, f ht 15 and ht35 distributions reflect the re-peopling of Europe from Iberia and Asia Minor during that period. The R1b3-M269 variances and expansion time estimates of Iberian and Turkish lineages are similar to each other (Table 2) but higher than observed elsewhere (Table 4). Low variances for R1b3-M269 lineages have also been reported for Czech and Estonian populations (Kivisild et al. 2003).

    In contrast, the R1-M173 related but offsetting clade R1a1-M17, is frequent (30–60%) in East Europe, Central Asia, and Northwest India (Semino et al. 2000a; Wells et al. 2001; Passarino et al. 2001; Kivisild et al. 2003). This pronounced R1-M173 related Y-chromosome substructure contrasts to the observed uniform frequency spectrum of the major mitochondrial DNA haplogroups in Europe. The higher frequency of R1a1-M17 lineages in eastern Turkey is consistent with an entry into Anatolia via the Iranian plateau where the associated variance is appreciably higher (Quintana-Murci et al. 2001). The most common R1a1-M17 haplotype in Armenia (Weale et al. 2001) matches the most common in Turkey.

    Haplogroup I-M170 indicates gene flows from Croatia
    The phylogeography and high associated variance of I-M170 is consistent with an in situ European origin of M170 in the Balkans (Semino et al. 2000a), possibly near the Dinaric Mountain chain in Croatia where it has been observed at the highest frequency known so far (Barac et al. 2003). I-M170 lineages radiated both towards north central Europe and into western Turkey. Comparison of STR haplotypes indicates that the Dinaric modal haplotype is associated with the I-P37 lineages observed in Turkey. Molecular analyses of I-M170 group lineages at equivalent resolution in modern day Bulgaria, Croatia and Greece will be required to better understand the phylogeography of I-M170 sub-clades.

    Haplogroup E3b and Neolithic expansions
    While both E3b1-M78 and E3b3-M123 occur at similar frequency in Turkey, the variance of the former is considerably lower than the latter suggesting either temporal or effective population size differences. The prevalence of haplogroup E (xM2) chromosomes in northern Egypt may reflect the source of non-African E3b lineages (Manni et al. 2002). Haplogroup E3b1-M78 haplotypes typify European lineages (Semino, unpublished) and have expansion dates consistent with expansion of agriculturalists (Table 2). Haplogroup J2-M172 lineages likely reflect the introduction of agriculture to India from the Middle East (Kivisild et al. 2003). However, the absence of E3b lineages in India supports the inference that the higher variance and older expansion dates for E3b3-M123 in Turkey do not reflect an earlier dispersal, but rather multiple founders with more associated diversity.

    The spread of haplogroup L-M11 lineages is largely restricted to populations of the south Caucasus (Weale et al. 2001), Middle East (Nebel et al. 2001b), Pakistan (Qamar et al. 2002) and India (Kivisild et al. 2003). Interestingly Turkish L lineages lack the M27 mutation that characterizes Indian and Pakistani L lineages. Although no M27 data exist for Armenians, the haplogroup L modal haplotype of the six STR loci in Armenians haplotype (Weale et al. 2001) matches the most common Turkish counterpart. An attempt to interpret other informative lineages in Turkey such as I1a-M253, J2a-M47, J2f-M67, K2-M70, N-M231 is premature until they are adequately surveyed elsewhere.

    Minor genetic influence of Turkic speakers
    Various estimates exist of the proportion of gene flow associated with the arrival of Central Asian Turkic speaking people to Anatolia. One study based on analyses of six STR loci in 88 Y-chromosomes from Turkey suggested only a 10% contribution (Rolf et al. 1999). Another study suggests roughly 30% based upon mtDNA control region sequences and one binary and six STR Y-chromosome loci analyzed in 118 Turkish samples (Di Benedetto et al. 2001). While it is likely that gene flow between Central Asia and Anatolia has occurred repeatedly throughout prehistory, uncertainties regarding source populations and the number of such episodes between Central Asia and Europe confound any assessment of the contribution of the 11th century AD Oghuz nomads responsible for the Turkic language replacement. These new Y-chromosome data provide candidate haplogroups to differentiate lineages specific to the postulated source populations, thus overcoming potential artifacts caused by indistinguishable overlapping gene flows. The best candidates for estimations are Asian-specific haplogroups C-RPS4Y (Wells et al. 2001; Karafet et al. 2001; Zerjal et al. 2003) and O3-M122 (Su et al. 2000). These lineages occur at 1.5% in Turkey (8/523). Using Central Asian Y-chromosome data from either 13 populations and 149 samples (Underhill et al. 2000) or 49 populations and 1,935 samples (Wells et al. 2001) where these diagnostic lineages occur at 33% and 18%, respectively, their estimated contributions range from 0.0153/0.329×100=4.6% to 0.0153/0.180×100=8.5%. During the Bronze Age the population of Anatolia expanded, reaching an estimated level of 12 million during the late Roman Period (Russell 1958). Such a large pre-existing Anatolian population would have reduced the impact by the subsequent arrival of Turkic speaking Seljuk and Osmanl groups from Central Asia. Although the genetic legacy of Anatolia remains somewhat inchoate, our excavations of these new levels of shared Y-chromosome heritage and subsequent diversification provide new clues to Anatolian prehistory, as well as a substantial foundation for comparisons with other populations. Our results demonstrate Anatolias role as a buffer between culturally and genetically distinct populations, being both an important source and recipient of gene flow.

    Acknowledgements We are grateful to all the donors for providing DNA samples for this study. This study was supported by NIH grants GM28428 and GM 55273 to L.L.C-S and by Progetti Ricerca Interesse Nazionale 2002 and CNR Beni Culturali to O.S. We thank C. Edmonds for regression analyses associated with DYS389 calibration.

    --------------------------------------------------------------------------------

    Electronic-database information
    BATWING. Bayesian analysis of trees with internal node generation, http://www.maths.abdn.ac.uk/~ijw (Aberdeen, UK: Department of Mathematical Sciences, University of Aberdeen).


    --------------------------------------------------------------------------------

    Appendix
    Table A
    The distribution of Y-chromosome haplotypes in nine regions of Turkey (the populations are grouped as given in Fig. 3): Haplotype number
    Haplogroup
    Region
    Allele status at
    Total

    DYS19
    DYS388
    DYS390
    DYS391
    DYS392
    DYS393
    DYS389I(CD)
    DYS389II(AB)
    DYS439
    DYSA7.2

    1
    A3b2-M13
    8
    15
    11
    21
    10
    11
    13
    13
    17
    12
    11
    1

    2
    A3b2-M13
    8
    16
    11
    21
    10
    11
    12
    13
    18
    14
    10
    1

    3
    C*-M216
    2
    14
    13
    25
    9
    11
    11
    13
    19
    11
    10
    1

    4
    C*-M216
    9
    15
    13
    25
    11
    11
    13
    14
    16
    11
    11
    1

    5
    C3-M217
    3
    15
    13
    24
    10
    11
    13
    13
    16
    12
    9
    1

    6
    C3-M217
    9
    15
    13
    23
    9
    11
    13
    15
    16
    11
    10
    1

    7
    C3-M217
    9
    15
    13
    24
    10
    11
    13
    13
    16
    12
    11
    1

    8
    C3-M217
    7
    16
    13
    25
    9
    13
    13
    14
    16
    11
    10
    1

    9
    C3-M217
    9
    17
    15
    25
    10
    11
    13
    13
    17
    10
    10
    1

    10
    E3*-PN2
    9
    13
    12
    20
    10
    11
    13
    14
    17
    12
    10
    1

    11
    E3*-PN2
    9
    14
    12
    21
    10
    11
    13
    13
    18
    13
    10
    1

    12
    E3a-M2
    9
    14
    12
    21
    10
    11
    13
    13
    16
    11
    10
    1

    13
    E3b1-M78
    1, 2, 4, 6
    13
    12
    24
    10
    11
    13
    13
    17
    12
    10
    7

    14
    E3b1-M78
    1, 3, 5
    13
    12
    24
    10
    11
    13
    14
    17
    12
    10
    3

    15
    E3b1-M78
    1, 3, 4
    13
    12
    24
    10
    11
    13
    13
    18
    12
    10
    3

    16
    E3b1-M78
    1
    13
    12
    24
    11
    11
    13
    14
    19
    12
    10
    1

    17
    E3b1-M78
    1
    13
    12
    26
    10
    11
    13
    14
    17
    13
    10
    1

    18
    E3b1-M78
    1
    13
    12
    24
    10
    11
    13
    15
    17
    13
    10
    1

    19
    E3b1-M78
    4
    13
    12
    24
    10
    11
    13
    12
    17
    10
    10
    1

    20
    E3b1-M78
    4
    13
    12
    25
    10
    11
    13
    13
    17
    12
    11
    1

    21
    E3b1-M78
    4
    13
    12
    25
    11
    11
    13
    13
    17
    13
    10
    1

    22
    E3b1-M78
    6
    13
    12
    24
    10
    11
    13
    13
    17
    12
    10
    1

    23
    E3b1-M78
    7
    13
    12
    24
    10
    11
    13
    14
    17
    11
    10
    1

    24
    E3b1-M78
    8
    13
    12
    25
    10
    11
    13
    13
    17
    13
    9
    1

    25
    E3b1-M78
    9
    13
    12
    23
    10
    11
    13
    13
    17
    12
    9
    1

    26
    E3b1-M78
    9
    13
    12
    24
    10
    11
    13
    13
    18
    12
    11
    1

    27
    E3b1-M78
    9
    13
    12
    26
    10
    11
    13
    13
    18
    11
    10
    1

    28
    E3b1-M78
    9
    13
    12
    23
    10
    11
    13
    14
    17
    12
    10
    1

    29
    E3b2-M81
    7
    13
    12
    24
    9
    11
    13
    14
    16
    11
    11
    1

    30
    E3b3-M123
    4, 5, 9
    13
    12
    22
    10
    11
    13
    12
    18
    12
    10
    4

    31
    E3b3-M123
    3, 9
    13
    12
    23
    9
    11
    14
    14
    18
    13
    9
    3

    32
    E3b3-M123
    1
    13
    12
    24
    10
    11
    13
    13
    20
    13
    10
    1

    33
    E3b3-M123
    3
    13
    12
    24
    9
    11
    14
    14
    17
    11
    9
    1

    34
    E3b3-M123
    3
    13
    12
    24
    10
    11
    13
    13
    19
    11
    10
    1

    35
    E3b3-M123
    3
    13
    12
    26
    9
    11
    13
    13
    18
    11
    10
    1

    36
    E3b3-M123
    4
    13
    11
    24
    10
    11
    13
    13
    15
    13
    10
    1

    37
    E3b3-M123
    4
    13
    12
    23
    10
    12
    13
    13
    19
    11
    10
    1

    38
    E3b3-M123
    4
    13
    12
    24
    10
    11
    13
    13
    18
    13
    10
    1

    39
    E3b3-M123
    4
    13
    12
    24
    10
    11
    13
    13
    18
    13
    10
    1

    40
    E3b3-M123
    5
    13
    12
    22
    10
    11
    14
    12
    18
    12
    10
    1

    41
    E3b3-M123
    6
    13
    12
    23
    10
    12
    13
    12
    17
    12
    11
    1

    42
    E3b3-M123
    6
    13
    12
    24
    10
    11
    13
    13
    18
    12
    8
    1

    43
    E3b3-M123
    7
    13
    12
    21
    10
    11
    13
    12
    18
    12
    10
    1

    44
    E3b3-M123
    7
    13
    12
    23
    8
    11
    13
    12
    19
    10
    11
    1

    45
    E3b3-M123
    7
    13
    12
    25
    10
    11
    13
    12
    16
    13
    11
    1

    46
    E3b3-M123
    7
    13
    12
    25
    9
    11
    13
    13
    18
    12
    9
    1

    47
    E3b3-M123
    8
    13
    12
    21
    9
    11
    14
    14
    17
    12
    9
    1

    48
    E3b3-M123
    9
    13
    12
    22
    10
    11
    13
    12
    18
    11
    10
    1

    49
    E3b3-M123
    9
    13
    12
    24
    10
    11
    13
    12
    18
    12
    11
    1

    50
    E3b3-M123
    7
    14
    12
    24
    10
    11
    13
    13
    17
    11
    10
    1

    51
    E3b3-M123
    7
    14
    12
    24
    9
    11
    14
    14
    17
    11
    9
    1

    52
    E3b3-M123
    1
    15
    12
    23
    10
    11
    13
    13
    17
    11
    9
    1

    53
    E3b3-M123
    6
    15
    12
    23
    9
    11
    14
    14
    19
    12
    9
    1

    54
    G*-M201
    4
    16
    12
    23
    10
    11
    13
    13
    16
    11
    10
    1

    55
    G1a-P20
    3
    15
    12
    24
    12
    12
    13
    13
    17
    13
    11
    1

    56
    G1a–P20
    3
    15
    12
    23
    10
    12
    13
    13
    17
    13
    11
    1

    57
    G1a–P20
    3
    16
    12
    23
    10
    12
    13
    13
    17
    12
    10
    1

    58
    G1a–P20
    3
    16
    12
    23
    10
    12
    13
    13
    17
    13
    11
    1

    59
    G1*-M342
    3
    15
    12
    23
    11
    12
    15
    12
    16
    11
    10
    1

    60
    G2*-P15
    4, 5, 9
    15
    13
    22
    10
    11
    13
    13
    17
    11
    10
    5

    61
    G2*-P15
    3, 7
    15
    12
    20
    10
    11
    14
    12
    16
    13
    9
    3

    62
    G2*-P15
    5, 7
    15
    12
    23
    10
    11
    14
    12
    17
    11
    9
    2

    63
    G2*-P15
    8
    14
    12
    21
    10
    11
    14
    12
    18
    11
    10
    1

    64
    G2*-P15
    4
    14
    12
    22
    10
    11
    14
    12
    17
    11
    10
    1

    65
    G2*-P15
    3
    15
    11
    21
    10
    11
    14
    12
    18
    12
    10
    1

    66
    G2*-P15
    6
    15
    12
    21
    10
    11
    15
    12
    16
    11
    9
    1

    67
    G2*-P15
    6
    15
    12
    21
    10
    11
    15
    12
    17
    14
    9
    1

    68
    G2*-P15
    7
    15
    12
    21
    10
    11
    14
    13
    16
    11
    9
    1

    69
    G2*-P15
    3
    15
    12
    21
    10
    11
    14
    12
    16
    11
    9
    1

    70
    G2*-P15
    7
    15
    12
    21
    10
    11
    13
    12
    16
    11
    9
    1

    71
    G2*-P15
    7
    15
    12
    21
    10
    11
    15
    12
    16
    11
    9
    1

    72
    G2*-P15
    4
    15
    12
    21
    10
    11
    14
    12
    17
    11
    9
    1

    73
    G2*-P15
    3
    15
    12
    21
    10
    11
    15
    12
    16
    11
    9
    1

    74
    G2*-P15
    3
    15
    12
    21
    10
    11
    14
    12
    16
    12
    9
    1

    75
    G2*-P15
    8
    15
    12
    21
    8
    11
    15
    12
    17
    13
    9
    1

    76
    G2*-P15
    8
    15
    12
    21
    8
    11
    15
    12
    16
    13
    9
    1

    77
    G2*-P15
    5
    15
    12
    21
    10
    11
    14
    12
    18
    11
    9
    1

    78
    G2*-P15
    3
    15
    12
    21
    10
    11
    15
    12
    18
    11
    9
    1

    79
    G2*-P15
    9
    15
    12
    21
    11
    11
    14
    12
    16
    12
    9
    1

    80
    G2*-P15
    2
    15
    12
    21
    10
    11
    14
    12
    16
    11
    9
    1

    81
    G2*-P15
    4
    15
    12
    22
    10
    11
    14
    12
    18
    11
    10
    1

    82
    G2*-P15
    4
    15
    12
    22
    10
    10
    14
    12
    18
    11
    11
    1

    83
    G2*-P15
    8
    15
    12
    22
    10
    10
    14
    13
    17
    12
    11
    1

    84
    G2*-P15
    6
    15
    12
    22
    10
    11
    14
    12
    16
    12
    9
    1

    85
    G2*-P15
    9
    15
    12
    22
    10
    10
    14
    11
    17
    12
    10
    1

    86
    G2*-P15
    7
    15
    12
    23
    10
    11
    14
    12
    16
    12
    10
    1

    87
    G2*-P15
    2
    15
    12
    23
    10
    11
    14
    12
    18
    11
    9
    1

    88
    G2*-P15
    7
    15
    12
    23
    10
    12
    14
    13
    18
    11
    10
    1

    89
    G2*-P15
    8
    15
    13
    21
    11
    11
    14
    12
    18
    12
    9
    1

    90
    G2*-P15
    7
    15
    13
    21
    10
    11
    15
    12
    17
    11
    9
    1

    91
    G2*-P15
    7
    16
    12
    22
    10
    10
    13
    12
    17
    11
    10
    1

    92
    G2*-P15
    2
    16
    12
    22
    10
    10
    14
    12
    17
    13
    10
    1

    93
    G2*-P15
    5
    16
    12
    22
    11
    10
    14
    12
    17
    12
    9
    1

    94
    G2*-P15
    9
    16
    13
    21
    10
    11
    14
    12
    16
    12
    9
    1

    95
    G2*-P15
    7
    17
    12
    21
    10
    11
    15
    12
    16
    11
    9
    1

    96
    G2*-P15
    1
    17
    12
    22
    10
    11
    14
    12
    17
    11
    10
    1

    97
    G2a-P16
    5, 9
    15
    12
    22
    10
    10
    14
    11
    16
    12
    10
    2

    98
    G2a-P16
    3
    15
    12
    22
    10
    11
    14
    12
    17
    11
    10
    1

    99
    G2a-P16
    9
    15
    12
    22
    10
    10
    15
    12
    17
    12
    10
    1

    100
    G2a-P16
    7
    16
    12
    22
    10
    10
    14
    13
    17
    12
    10
    1

    101
    G2b-M286
    1
    15
    12
    22
    10
    11
    15
    13
    17
    12
    11
    1

    102
    G3-M287
    8
    15
    12
    22
    10
    10
    13
    12
    17
    11
    10
    1

    103
    H*-M52
    7
    15
    12
    22
    10
    11
    12
    13
    16
    11
    10
    1

    104
    H*-M52
    4
    15
    13
    22
    10
    12
    12
    14
    17
    11
    10
    1

    105
    H1a-M370
    1
    15
    12
    22
    10
    11
    12
    14
    16
    11
    10
    1

    106
    I*-M170
    1
    14
    14
    22
    10
    11
    13
    12
    16
    10
    10
    1

    107
    I*-M170
    9
    14
    13
    21
    10
    11
    13
    13
    17
    10
    11
    1

    108
    I*-M170
    9
    15
    13
    24
    10
    11
    14
    13
    17
    12
    10
    1

    109
    I*-M170
    1
    15
    13
    24
    10
    11
    15
    14
    17
    12
    10
    1

    110
    I*-M170
    3
    15
    13
    24
    10
    11
    13
    13
    17
    11
    10
    1

    111
    I*-M170
    7
    15
    13
    24
    10
    11
    14
    14
    17
    13
    10
    1

    112
    I1a-M253
    2, 5, 7
    14
    14
    23
    10
    11
    13
    12
    16
    12
    10
    3

    113
    I1a-M253
    1
    14
    14
    23
    10
    12
    13
    12
    16
    11
    10
    1

    114
    I1a-M253
    1
    14
    14
    23
    10
    11
    14
    12
    16
    10
    10
    1

    115
    I1a-M253
    6
    15
    14
    23
    10
    11
    13
    12
    17
    11
    10
    1

    116
    I1b*-P37
    5, 9
    16
    13
    24
    11
    11
    13
    13
    18
    12
    10
    2

    117
    I1b*-P37
    8
    15
    13
    24
    11
    11
    13
    13
    19
    12
    10
    1

    118
    I1b*-P37
    9
    15
    13
    24
    11
    11
    13
    13
    18
    13
    10
    1

    119
    I1b*-P37
    1
    16
    13
    24
    11
    11
    13
    14
    18
    12
    9
    1

    120
    I1b*-P37
    3
    16
    13
    24
    11
    11
    13
    13
    18
    12
    11
    1

    121
    I1b*-P37
    7
    16
    13
    24
    10
    11
    13
    12
    18
    11
    9
    1

    122
    I1b*-P37
    9
    16
    13
    24
    10
    11
    13
    13
    17
    12
    10
    1

    123
    I1b*-P37
    9
    16
    13
    24
    12
    11
    13
    13
    18
    12
    10
    1

    124
    I1b*-P37
    9
    16
    13
    24
    11
    11
    13
    13
    19
    12
    10
    1

    125
    I1b*-P37
    2
    17
    13
    24
    10
    11
    13
    13
    19
    11
    11
    1

    126
    I1b*-P37
    8
    17
    13
    24
    10
    11
    13
    13
    19
    13
    10
    1

    127
    I1b1-M359
    9
    16
    13
    24
    11
    11
    13
    12
    18
    14
    10
    1

    128
    I1c-M223
    1
    15
    13
    23
    10
    12
    14
    13
    16
    12
    10
    1

    129
    I1c-M223
    2
    15
    13
    23
    10
    12
    13
    14
    16
    12
    12
    1

    130
    I1c-M223
    7
    15
    13
    23
    10
    11
    14
    14
    17
    11
    9
    1

    131
    J*-M304
    5
    15
    12
    23
    10
    11
    14
    13
    18
    11
    9
    1

    132
    J1*-M267
    4
    13
    15
    25
    10
    11
    12
    12
    17
    12
    9
    2

    133
    J1*-M267
    3, 4
    14
    13
    23
    10
    11
    12
    14
    18
    11
    9
    2

    134
    J1*-M267
    3, 7
    14
    13
    23
    10
    11
    12
    13
    16
    12
    10
    2

    135
    J1*-M267
    2, 7
    14
    15
    25
    9
    11
    12
    13
    17
    12
    9
    2

    136
    J1*-M267
    6
    14
    16
    23
    10
    11
    12
    13
    18
    11
    9
    2

    137
    J1*-M267
    3, 9
    14
    17
    23
    11
    11
    12
    13
    17
    11
    9
    2

    138
    J1*-M267
    4 ,9
    14
    17
    24
    10
    11
    12
    13
    17
    11
    9
    2

    139
    J1*-M267
    1
    15
    16
    23
    10
    11
    12
    13
    16
    11
    9
    2

    140
    J1*-M267
    3
    14
    13
    23
    10
    11
    12
    14
    18
    11
    9
    1

    141
    J1*-M267
    3
    14
    13
    23
    10
    11
    12
    14
    19
    11
    11
    1

    142
    J1*-M267
    1
    14
    13
    23
    10
    11
    12
    14
    16
    11
    10
    1

    143
    J1*-M267
    8
    14
    15
    24
    10
    13
    12
    13
    16
    12
    9
    1

    144
    J1*-M267
    9
    14
    15
    25
    11
    11
    12
    13
    16
    12
    9
    1

    145
    J1*-M267
    3
    14
    15
    25
    10
    11
    12
    13
    17
    12
    10
    1

    146
    J1*-M267
    7
    14
    16
    21
    10
    11
    12
    13
    18
    13
    9
    1

    147
    J1*-M267
    1
    14
    16
    21
    10
    11
    12
    13
    17
    11
    9
    1

    148
    J1*-M267
    5
    14
    16
    22
    10
    11
    12
    13
    17
    12
    9
    1

    149
    J1*-M267
    6
    14
    16
    23
    10
    11
    12
    13
    16
    11
    9
    1

    150
    J1*-M267
    6
    14
    16
    23
    10
    11
    12
    13
    15
    11
    9
    1

    151
    J1*-M267
    5
    14
    16
    23
    10
    11
    12
    13
    18
    12
    9
    1

    152
    J1*-M267
    7
    14
    16
    23
    10
    11
    12
    13
    16
    12
    9
    1

    153
    J1*-M267
    3
    14
    16
    23
    10
    11
    12
    13
    17
    12
    9
    1

    154
    J1*-M267
    4
    14
    16
    24
    10
    13
    13
    13
    16
    12
    9
    1

    155
    J1*-M267
    3
    14
    16
    24
    9
    11
    12
    13
    18
    12
    9
    1

    156
    J1*-M267
    4
    14
    17
    23
    11
    11
    12
    14
    17
    12
    9
    1

    157
    J1*-M267
    1
    14
    17
    23
    11
    11
    12
    13
    17
    10
    9
    1

    158
    J1*-M267
    4
    14
    17
    23
    9
    11
    12
    13
    18
    12
    9
    1

    159
    J1*-M267
    9
    14
    17
    23
    10
    11
    12
    13
    17
    11
    9
    1

    160
    J1*-M267
    9
    14
    17
    23
    11
    11
    12
    12
    16
    12
    9
    1

    161
    J1*-M267
    9
    14
    17
    23
    10
    11
    12
    13
    17
    11
    10
    1

    162
    J1*-M267
    7
    14
    17
    24
    10
    11
    12
    13
    18
    12
    9
    1

    163
    J1*-M267
    4
    15
    13
    23
    9
    11
    12
    14
    17
    11
    10
    1

    164
    J1*-M267
    1
    15
    15
    23
    11
    13
    12
    13
    16
    11
    9
    1

    165
    J1*-M267
    6
    15
    15
    23
    11
    11
    12
    13
    17
    12
    9
    1

    166
    J1*-M267
    1
    15
    16
    23
    10
    11
    12
    13
    16
    11
    9
    1

    167
    J1*-M267
    1
    15
    16
    24
    10
    11
    12
    13
    17
    11
    11
    1

    168
    J1a-M365
    4
    15
    16
    22
    10
    11
    14
    13
    15
    12
    8
    1

    169
    J1b-M368
    2
    14
    15
    22
    10
    11
    12
    13
    17
    12
    11
    1

    170
    J1c-M369
    4
    14
    16
    23
    10
    11
    12
    13
    17
    11
    9
    1

    171
    J2*-M172
    4
    16
    15
    23
    10
    11
    12
    13
    16
    11
    12
    5

    172
    J2*-M172
    4, 7
    14
    15
    23
    10
    11
    12
    14
    16
    11
    10
    3

    173
    J2*-M172
    7
    15
    16
    23
    9
    11
    12
    13
    16
    11
    12
    2

    174
    J2*-M172
    5, 6
    15
    15
    23
    11
    11
    12
    13
    16
    11
    12
    2

    175
    J2*-M172
    1
    13
    15
    22
    10
    11
    12
    14
    18
    11
    11
    1

    176
    J2*-M172
    7
    13
    15
    23
    10
    11
    12
    13
    16
    11
    10
    1

    177
    J2*-M172
    4
    13
    15
    24
    10
    11
    12
    13
    16
    11
    11
    1

    178
    J2*-M172
    7
    13
    17
    23
    11
    11
    12
    12
    14
    11
    11
    1

    179
    J2*-M172
    3
    14
    15
    23
    10
    10
    12
    14
    16
    11
    11
    1

    180
    J2*-M172
    3
    14
    15
    24
    10
    10
    12
    13
    16
    11
    11
    1

    181
    J2*-M172
    7
    14
    14
    21
    10
    11
    12
    13
    17
    12
    11
    1

    182
    J2*-M172
    2
    14
    14
    23
    10
    11
    12
    13
    16
    12
    11
    1

    183
    J2*-M172
    2
    14
    14
    23
    10
    11
    12
    14
    16
    11
    10
    1

    184
    J2*-M172
    1
    14
    14
    24
    10
    11
    12
    13
    16
    11
    11
    1

    185
    J2*-M172
    1
    14
    14
    24
    10
    11
    12
    13
    16
    12
    11
    1

    186
    J2*-M172
    8
    14
    14
    24
    10
    11
    12
    13
    16
    13
    11
    1

    187
    J2*-M172
    7
    14
    14
    24
    10
    11
    12
    14
    17
    11
    11
    1

    188
    J2*-M172
    9
    14
    15
    22
    9
    11
    12
    14
    15
    11
    10
    1

    189
    J2*-M172
    1
    14
    15
    23
    9
    11
    12
    13
    16
    11
    10
    1

    190
    J2*-M172
    8
    14
    16
    22
    9
    11
    12
    14
    16
    10
    9
    1

    191
    J2*-M172
    1
    14
    15
    23
    10
    11
    12
    13
    15
    13
    11
    1

    192
    J2*-M172
    4
    14
    15
    23
    10
    11
    12
    14
    16
    11
    11
    1

    193
    J2*-M172
    2
    14
    15
    25
    10
    11
    12
    12
    17
    11
    10
    1

    194
    J2*-M172
    7
    14
    16
    23
    10
    11
    12
    12
    16
    13
    9
    1

    195
    J2*-M172
    9
    14
    16
    23
    10
    11
    12
    12
    17
    12
    9
    1

    196
    J2*-M172
    3
    14
    16
    25
    10
    11
    12
    13
    16
    13
    10
    1

    197
    J2*-M172
    5
    14
    17
    23
    10
    11
    12
    13
    16
    12
    10
    1

    198
    J2*-M172
    3
    14
    17
    23
    10
    11
    12
    12
    16
    14
    11
    1

    199
    J2*-M172
    4
    14
    17
    23
    10
    11
    12
    12
    16
    12
    8
    1

    200
    J2*-M172
    5
    14
    17
    23
    10
    11
    12
    12
    16
    12
    10
    1

    201
    J2*-M172
    7
    14
    17
    23
    10
    11
    12
    12
    16
    11
    11
    1

    202
    J2*-M172
    1
    14
    14
    24
    10
    11
    13
    13
    16
    11
    11
    1

    203
    J2*-M172
    7
    14
    15
    22
    11
    11
    12
    13
    17
    12
    10
    1

    204
    J2*-M172
    1
    14
    15
    23
    11
    11
    12
    13
    17
    11
    11
    1

    205
    J2*-M172
    1
    14
    15
    25
    11
    11
    12
    13
    17
    12
    11
    1

    206
    J2*-M172
    7
    14
    15
    25
    11
    11
    12
    14
    17
    12
    10
    1

    207
    J2*-M172
    5
    14
    17
    23
    11
    11
    12
    12
    16
    13
    11
    1

    208
    J2*-M172
    7
    14
    17
    23
    11
    11
    12
    12
    17
    12
    10
    1

    209
    J2*-M172
    5
    14
    17
    23
    11
    11
    13
    12
    17
    12
    10
    1

    210
    J2*-M172
    2
    15
    16
    23
    9
    11
    12
    14
    16
    11
    11
    1

    211
    J2*-M172
    7
    15
    16
    24
    9
    11
    12
    13
    16
    12
    11
    1

    212
    J2*-M172
    6
    15
    15
    24
    9
    11
    15
    13
    16
    12
    10
    1

    213
    J2*-M172
    6
    15
    16
    23
    9
    11
    15
    13
    16
    12
    10
    1

    214
    J2*-M172
    2
    15
    14
    24
    10
    11
    12
    13
    18
    13
    11
    1

    215
    J2*-M172
    4
    15
    14
    25
    10
    11
    12
    13
    18
    12
    11
    1

    216
    J2*-M172
    3
    15
    15
    22
    10
    11
    12
    13
    17
    11
    10
    1

    217
    J2*-M172
    7
    15
    15
    23
    10
    11
    12
    13
    16
    11
    11
    1

    218
    J2*-M172
    4
    15
    15
    23
    10
    11
    12
    13
    16
    11
    12
    1

    219
    J2*-M172
    5
    15
    15
    23
    10
    11
    12
    13
    16
    11
    10
    1

    220
    J2*-M172
    9
    15
    15
    23
    10
    11
    12
    13
    17
    12
    10
    1

    221
    J2*-M172
    1
    15
    15
    23
    10
    11
    12
    13
    17
    13
    11
    1

    222
    J2*-M172
    6
    15
    15
    23
    10
    11
    12
    13
    18
    12
    11
    1

    223
    J2*-M172
    7
    15
    15
    23
    10
    11
    12
    14
    18
    11
    12
    1

    224
    J2*-M172
    7
    15
    15
    23
    10
    11
    12
    13
    18
    11
    11
    1

    225
    J2*-M172
    3
    15
    15
    24
    10
    11
    12
    12
    16
    13
    10
    1

    226
    J2*-M172
    3
    15
    15
    24
    10
    11
    12
    12
    16
    12
    10
    1

    227
    J2*-M172
    3
    15
    15
    24
    10
    11
    12
    12
    16
    12
    10
    1

    228
    J2*-M172
    6
    15
    15
    24
    10
    11
    12
    13
    17
    11
    11
    1

    229
    J2*-M172
    7
    15
    15
    24
    10
    11
    12
    13
    19
    12
    10
    1

    230
    J2*-M172
    4
    15
    15
    25
    10
    11
    12
    13
    17
    11
    10
    1

    231
    J2*-M172
    2
    15
    16
    23
    10
    11
    12
    13
    16
    12
    11
    1

    232
    J2*-M172
    9
    15
    16
    23
    10
    11
    12
    13
    17
    11
    11
    1

    233
    J2*-M172
    5
    15
    17
    23
    10
    11
    12
    12
    16
    11
    12
    1

    234
    J2*-M172
    2
    15
    15
    24
    11
    11
    12
    13
    16
    13
    11
    1

    235
    J2*-M172
    6
    15
    15
    24
    11
    11
    12
    13
    17
    11
    11
    1

    236
    J2*-M172
    5
    16
    15
    23
    10
    11
    12
    13
    17
    12
    12
    1

    237
    J2*-M172
    4
    16
    15
    24
    10
    11
    12
    13
    16
    11
    12
    1

    238
    J2a-M47
    9
    14
    15
    23
    10
    11
    12
    13
    16
    11
    9
    2

    239
    J2a-M47
    4
    14
    15
    23
    10
    11
    12
    13
    16
    11
    8
    1

    240
    J2a-M47
    7
    14
    15
    21
    10
    11
    12
    13
    16
    11
    9
    1

    241
    J2a-M47
    4
    14
    15
    23
    10
    11
    12
    13
    17
    11
    8
    1

    242
    J2a-M47
    9
    14
    15
    23
    10
    11
    12
    14
    17
    11
    10
    1

    243
    J2d-M158
    3
    15
    15
    25
    10
    11
    12
    14
    16
    12
    11
    1

    244
    J2d-M158
    5
    15
    17
    23
    10
    11
    12
    12
    16
    11
    11
    1

    245
    J2e*-M12
    4
    15
    15
    24
    11
    11
    12
    12
    15
    12
    8
    2

    246
    J2e*-M12
    3
    15
    15
    23
    10
    11
    12
    12
    16
    11
    8
    1

    247
    J2e*-M12
    4
    15
    15
    24
    11
    11
    12
    12
    15
    13
    8
    1

    248
    J2e1-M241
    9
    15
    14
    24
    10
    11
    12
    12
    16
    11
    8
    1

    249
    J2e1-M241
    9
    15
    15
    24
    10
    11
    12
    12
    16
    12
    8
    1

    250
    J2e1-M241
    6
    15
    16
    24
    10
    11
    12
    12
    15
    11
    8
    1

    251
    J2e1-M241
    5
    16
    15
    24
    10
    11
    13
    12
    16
    11
    7
    1

    252
    J2e1-M241
    5
    17
    15
    25
    10
    11
    13
    12
    16
    11
    7
    1

    253
    J2f1-M92
    1
    14
    15
    22
    10
    11
    12
    13
    15
    12
    10
    1

    254
    J2f1-M92
    7
    14
    15
    22
    10
    11
    12
    13
    16
    11
    11
    1

    255
    J2f1-M92
    1
    14
    15
    22
    10
    11
    12
    13
    16
    11
    10
    1

    256
    J2f1-M92
    7
    14
    15
    22
    10
    11
    12
    13
    17
    12
    11
    1

    257
    J2f1-M92
    7
    14
    15
    22
    10
    11
    12
    13
    17
    11
    10
    1

    258
    J2f1-M92
    8
    14
    15
    22
    10
    11
    12
    12
    17
    11
    11
    1

    259
    J2f1-M92
    7
    14
    16
    23
    10
    11
    12
    13
    17
    11
    11
    1

    260
    J2f1-M92
    4
    14
    15
    22
    11
    11
    12
    13
    16
    11
    11
    1

    261
    J2f1-M92
    3
    14
    15
    23
    11
    11
    12
    14
    17
    12
    10
    1

    262
    J2f1-M92
    7
    14
    15
    22
    11
    12
    12
    13
    17
    11
    11
    1

    263
    J2f1-M92
    9
    15
    15
    22
    9
    11
    12
    13
    15
    11
    11
    1

    264
    J2f1-M92
    9
    15
    15
    22
    9
    11
    12
    13
    NAb
    12
    11
    1

    265
    J2f1-M92
    1
    15
    15
    22
    10
    12
    13
    13
    18
    11
    11
    1

    266
    J2f1-M92
    7
    17
    15
    22
    10
    11
    12
    13
    15
    11
    11
    1

    267
    J2f*-M67
    1
    14
    15
    22
    9
    11
    12
    13
    16
    11
    11
    1

    268
    J2f*-M67
    2
    14
    15
    23
    10
    11
    12
    14
    16
    11
    11
    1

    269
    J2f*-M67
    9
    14
    15
    23
    10
    11
    12
    13
    16
    11
    10
    1

    270
    J2f*-M67
    3
    14
    15
    23
    10
    11
    12
    14
    16
    10
    9
    1

    271
    J2f*-M67
    1
    14
    15
    23
    10
    11
    12
    14
    17
    11
    11
    1

    272
    J2f*-M67
    9
    14
    15
    23
    10
    11
    12
    14
    17
    12
    12
    1

    273
    J2f*-M67
    3
    14
    15
    23
    10
    11
    12
    13
    17
    11
    12
    1

    274
    J2f*-M67
    9
    14
    15
    23
    10
    11
    13
    15
    18
    12
    11
    1

    275
    J2f*-M67
    3
    14
    15
    23
    11
    11
    12
    13
    17
    11
    11
    1

    276
    J2f*-M67
    9
    14
    15
    23
    11
    11
    12
    14
    17
    11
    11
    1

    277
    J2f*-M67
    7
    14
    15
    23
    11
    11
    12
    13
    17
    12
    11
    1

    278
    J2f*-M67
    1
    14
    15
    24
    10
    11
    12
    13
    16
    11
    11
    1

    279
    J2f*-M67
    1
    14
    16
    23
    10
    11
    12
    13
    17
    11
    10
    1

    280
    J2f*-M67
    7
    14
    16
    23
    10
    11
    12
    14
    17
    11
    10
    1

    281
    J2f*-M67
    3
    14
    16
    23
    10
    11
    12
    14
    17
    13
    12
    1

    282
    J2f*-M67
    6
    14
    16
    23
    10
    11
    12
    13
    18
    11
    9
    1

    283
    J2f*-M67
    4
    14
    16
    23
    10
    11
    12
    13
    18
    11
    11
    1

    284
    J2f*-M67
    9
    15
    14
    23
    11
    11
    12
    13
    16
    10
    10
    1

    285
    J2f*-M67
    3
    15
    15
    23
    11
    13
    12
    13
    18
    11
    11
    1

    286
    J2g-M339
    4
    14
    17
    23
    10
    11
    12
    12
    16
    12
    12
    1

    287
    J2h-M340
    8
    14
    14
    24
    10
    11
    12
    14
    16
    14
    10
    1

    288
    K2-M70
    7
    14
    12
    24
    10
    13
    13
    13
    16
    11
    9
    2

    289
    K2-M70
    3
    13
    12
    23
    10
    13
    13
    14
    16
    12
    9
    1

    290
    K2-M70
    9
    13
    12
    24
    10
    13
    13
    14
    16
    11
    9
    1

    291
    K2-M70
    3
    13
    13
    23
    10
    13
    13
    14
    16
    12
    9
    1

    292
    K2-M70
    5
    14
    12
    22
    10
    13
    13
    14
    16
    11
    9
    1

    293
    K2-M70
    4
    14
    12
    23
    10
    13
    14
    14
    16
    12
    9
    1

    294
    K2-M70
    5
    14
    12
    24
    10
    13
    13
    14
    16
    11
    9
    1

    295
    K2-M70
    7
    14
    12
    24
    11
    13
    14
    13
    17
    12
    10
    1

    296
    K2-M70
    6
    14
    13
    22
    9
    11
    13
    13
    17
    12
    9
    1

    297
    K2-M70
    9
    14
    14
    23
    11
    13
    13
    13
    17
    12
    9
    1

    298
    K2-M70
    9
    15
    12
    23
    11
    14
    12
    13
    17
    12
    9
    1

    299
    K2-M70
    8
    16
    13
    24
    11
    13
    13
    14
    16
    13
    9
    1

    300
    L*-M11
    1, 3
    15
    12
    23
    10
    13
    11
    13
    17
    12
    10
    2

    301
    L*-M11
    3
    15
    12
    23
    10
    13
    11
    13
    17
    12
    10
    2

    302
    L*-M11
    4, 9
    16
    12
    24
    10
    15
    11
    13
    16
    11
    10
    2

    303
    L*-M11
    7
    12
    12
    22
    10
    14
    11
    12
    16
    12
    9
    1

    304
    L*-M11
    7
    12
    12
    22
    10
    14
    11
    12
    16
    13
    9
    1

    305
    L*-M11
    8
    14
    13
    23
    9
    14
    11
    13
    17
    11
    12
    1

    306
    L*-M11
    4
    15
    12
    23
    11
    15
    11
    13
    17
    12
    10
    1

    307
    L*-M11
    3
    15
    12
    23
    10
    13
    11
    13
    17
    13
    10
    1

    308
    L*-M11
    3
    15
    12
    23
    10
    15
    11
    13
    17
    13
    9
    1

    309
    L*-M11
    3
    15
    12
    23
    11
    13
    11
    13
    17
    13
    10
    1

    310
    L*-M11
    3
    15
    12
    23
    10
    13
    11
    13
    17
    13
    10
    1

    311
    L*-M11
    9
    15
    12
    23
    10
    13
    11
    13
    17
    12
    10
    1

    312
    L*-M11
    3
    15
    12
    23
    10
    13
    12
    13
    17
    12
    10
    1

    313
    L*-M11
    3
    15
    12
    23
    10
    13
    11
    13
    18
    13
    10
    1

    314
    L*-M11
    7
    15
    12
    23
    10
    14
    11
    14
    17
    12
    10
    1

    315
    L*-M11
    9
    16
    12
    23
    10
    16
    11
    14
    17
    12
    10
    1

    316
    L*-M11
    3
    16
    12
    23
    11
    13
    13
    13
    17
    12
    10
    1

    317
    L*-M11
    9
    16
    12
    23
    10
    14
    11
    13
    17
    14
    10
    1

    318
    L2-M349
    4
    14
    12
    23
    10
    14
    12
    14
    16
    13
    9
    1

    319
    N*-M231
    3, 4
    14
    12
    23
    10
    14
    13
    13
    16
    10
    11
    4

    320
    N*-M231
    3
    14
    12
    23
    10
    14
    13
    13
    16
    11
    11
    1

    321
    N*-M231
    3
    14
    12
    23
    10
    14
    13
    13
    16
    10
    10
    1

    322
    N*-M231
    9
    14
    12
    23
    10
    14
    13
    13
    17
    10
    11
    1

    323
    N*-M231
    3
    14
    12
    23
    10
    13
    13
    13
    16
    10
    11
    1

    324
    N*-M231
    7
    14
    12
    23
    10
    14
    13
    13
    17
    10
    11
    1

    325
    N*-M231
    8
    14
    12
    23
    10
    14
    13
    13
    15
    10
    11
    1

    326
    N*-M231
    8
    14
    12
    23
    10
    14
    13
    11
    16
    10
    11
    1

    327
    N*-M231
    3
    14
    13
    24
    10
    14
    13
    14
    17
    11
    9
    1

    328
    N*-M231
    5
    15
    12
    23
    11
    14
    13
    13
    16
    10
    11
    1

    329
    N*-M231
    6
    15
    12
    23
    10
    14
    13
    13
    16
    10
    11
    1

    330
    N*-M231
    7
    15
    12
    24
    10
    14
    13
    15
    16
    10
    11
    1

    331
    N3a-M178
    7
    14
    12
    23
    10
    14
    14
    14
    16
    10
    10
    1

    332
    N3a-M178
    8
    14
    12
    23
    10
    14
    14
    13
    17
    10
    10
    1

    333
    N3a-M178
    9
    14
    12
    23
    11
    17
    15
    14
    16
    10
    10
    1

    334
    N3a-M178
    7
    14
    12
    23
    11
    15
    15
    14
    16
    10
    10
    1

    335
    N3a-M178
    7
    15
    12
    23
    11
    14
    14
    14
    16
    11
    10
    1

    336
    O3-M122
    3
    15
    10
    23
    10
    14
    12
    12
    15
    12
    11
    1

    337
    Q*-M242
    7
    13
    12
    22
    10
    15
    13
    14
    16
    11
    11
    1

    338
    Q*-M242
    4
    13
    12
    22
    10
    15
    13
    13
    16
    12
    11
    1

    339
    Q*-M242
    7
    13
    12
    22
    10
    15
    13
    13
    16
    11
    11
    1

    340
    Q*-M242
    8
    13
    12
    22
    10
    15
    13
    13
    17
    12
    11
    1

    341
    Q*-M242
    4
    13
    12
    22
    10
    14
    14
    13
    17
    12
    10
    1

    342
    Q*-M242
    7
    13
    12
    22
    9
    15
    13
    13
    16
    12
    11
    1

    343
    Q*-M242
    3
    13
    12
    25
    10
    13
    13
    13
    18
    13
    11
    1

    344
    Q*-M242
    4
    14
    12
    22
    11
    15
    13
    13
    16
    11
    12
    1

    345
    Q*-M242
    4
    15
    12
    24
    10
    14
    14
    12
    17
    13
    10
    1

    346
    Q2-M25
    4
    13
    12
    23
    10
    16
    13
    13
    15
    13
    10
    1

    347
    R1*-M173
    5
    15
    12
    23
    11
    13
    13
    13
    17
    13
    9
    1

    348
    R1a1-M17
    4, 5, 8
    16
    12
    25
    11
    11
    13
    13
    17
    10
    9
    5

    349
    R1a1-M17
    4
    15
    12
    25
    11
    11
    13
    14
    16
    10
    9
    2

    350
    R1a1-M17
    1, 9
    17
    12
    25
    11
    11
    13
    13
    17
    11
    10
    2

    351
    R1a1-M17
    7
    14
    13
    25
    11
    11
    13
    13
    17
    11
    9
    1

    352
    R1a1-M17
    3
    15
    12
    24
    10
    11
    13
    12
    17
    10
    9
    1

    353
    R1a1-M17
    5
    15
    12
    24
    12
    11
    13
    13
    17
    10
    9
    1

    354
    R1a1-M17
    4
    15
    12
    25
    11
    11
    13
    13
    18
    10
    9
    1

    355
    R1a1-M17
    5
    15
    12
    25
    11
    11
    13
    13
    17
    10
    9
    1

    356
    R1a1-M17
    7
    15
    12
    25
    11
    11
    13
    14
    16
    11
    10
    1

    357
    R1a1-M17
    3
    15
    12
    25
    11
    11
    14
    14
    16
    10
    9
    1

    358
    R1a1-M17
    4
    15
    12
    25
    11
    11
    13
    14
    18
    10
    9
    1

    359
    R1a1-M17
    9
    15
    12
    25
    10
    11
    13
    13
    17
    10
    9
    1

    360
    R1a1-M17
    4
    15
    12
    25
    11
    11
    13
    12
    17
    10
    9
    1

    361
    R1a1-M17
    7
    15
    12
    25
    11
    11
    13
    13
    19
    10
    9
    1

    362
    R1a1-M17
    5
    16
    11
    25
    10
    11
    13
    13
    15
    11
    9
    1

    363
    R1a1-M17
    7
    16
    12
    23
    11
    11
    13
    13
    17
    11
    9
    1

    364
    R1a1-M17
    9
    16
    12
    24
    11
    11
    13
    13
    17
    10
    9
    1

    365
    R1a1-M17
    3
    16
    12
    24
    10
    11
    13
    13
    18
    11
    9
    1

    366
    R1a1-M17
    6
    16
    12
    24
    11
    11
    13
    13
    17
    10
    9
    1

    367
    R1a1-M17
    3
    16
    12
    24
    11
    11
    13
    13
    16
    10
    9
    1

    368
    R1a1-M17
    7
    16
    12
    25
    10
    11
    13
    13
    16
    11
    9
    1

    369
    R1a1-M17
    9
    16
    12
    25
    10
    11
    13
    14
    17
    10
    9
    1

    370
    R1a1-M17
    1
    16
    12
    25
    11
    11
    14
    13
    19
    10
    9
    1

    371
    R1a1-M17
    9
    16
    12
    25
    11
    11
    13
    12
    18
    11
    9
    1

    372
    R1a1-M17
    9
    16
    12
    25
    10
    11
    13
    13
    17
    10
    10
    1

    373
    R1a1-M17
    4
    16
    12
    25
    11
    11
    13
    12
    18
    11
    9
    1

    374
    R1a1-M17
    5
    16
    12
    25
    10
    11
    13
    13
    17
    10
    9
    1

    375
    R1a1-M17
    6
    16
    12
    26
    10
    11
    13
    13
    18
    10
    10
    1

    376
    R1a1-M17
    9
    16
    12
    26
    10
    11
    13
    13
    16
    11
    9
    1

    377
    R1a1-M17
    6
    17
    12
    25
    11
    11
    13
    13
    18
    10
    10
    1

    378
    R1b*-P25
    2
    15
    12
    24
    10
    14
    13
    13
    16
    12
    10
    1

    379
    R1b*-P25
    4
    15
    13
    23
    10
    13
    13
    13
    16
    13
    9
    1

    380
    R1b3-M269
    1, 4, 6, 7
    14
    12
    24
    11
    13
    12
    13
    16
    12
    9
    7

    381
    R1b3-M269
    5, 6
    14
    12
    25
    11
    13
    12
    13
    16
    11
    9
    3

    382
    R1b3-M269
    7, 9
    14
    12
    23
    10
    13
    12
    13
    16
    12
    9
    2

    383
    R1b3-M269
    3, 5
    14
    12
    24
    10
    13
    12
    13
    16
    12
    11
    2

    384
    R1b3-M269
    4
    14
    12
    24
    11
    13
    12
    13
    16
    13
    9
    2

    385
    R1b3-M269
    3
    14
    12
    24
    11
    13
    13
    12
    16
    14
    9
    2

    386
    R1b3-M269
    1, 9
    14
    12
    24
    11
    14
    12
    13
    15
    12
    9
    2

    387
    R1b3-M269
    7, 8
    15
    12
    24
    11
    13
    12
    13
    16
    12
    9
    2

    388
    R1b3-M269
    3
    13
    12
    24
    11
    13
    12
    13
    17
    14
    9
    1

    389
    R1b3-M269
    4
    13
    12
    25
    11
    13
    12
    13
    16
    12
    9
    1

    390
    R1b3-M269
    9
    13
    12
    25
    11
    13
    12
    13
    18
    11
    9
    1

    391
    R1b3-M269
    8
    13
    12
    25
    11
    13
    12
    13
    17
    12
    9
    1

    392
    R1b3-M269
    2
    14
    12
    23
    11
    13
    13
    13
    15
    12
    10
    1

    393
    R1b3-M269
    9
    14
    12
    23
    10
    14
    12
    13
    15
    12
    9
    1

    394
    R1b3-M269
    4
    14
    12
    23
    11
    11
    12
    13
    15
    12
    9
    1

    395
    R1b3-M269
    3
    14
    12
    23
    11
    13
    12
    13
    16
    11
    10
    1

    396
    R1b3-M269
    2
    14
    12
    23
    10
    13
    12
    14
    17
    12
    10
    1

    397
    R1b3-M269
    7
    14
    12
    24
    10
    12
    12
    13
    16
    12
    10
    1

    398
    R1b3-M269
    9
    14
    12
    24
    10
    13
    12
    13
    18
    11
    9
    1

    399
    R1b3-M269
    2
    14
    12
    24
    10
    13
    12
    14
    16
    13
    10
    1

    400
    R1b3-M269
    5
    14
    12
    24
    10
    14
    12
    12
    15
    12
    10
    1

    401
    R1b3-M269
    5
    14
    12
    24
    10
    14
    12
    12
    15
    12
    9
    1

    402
    R1b3-M269
    2
    14
    12
    24
    10
    14
    12
    13
    15
    13
    9
    1

    403
    R1b3-M269
    3
    14
    12
    24
    10
    14
    12
    12
    15
    12
    10
    1

    404
    R1b3-M269
    7
    14
    12
    24
    10
    14
    12
    13
    16
    13
    9
    1

    405
    R1b3-M269
    7
    14
    12
    24
    10
    14
    12
    13
    15
    11
    10
    1

    406
    R1b3-M269
    3
    14
    12
    24
    10
    15
    12
    13
    15
    12
    9
    1

    407
    R1b3-M269
    7
    14
    12
    24
    11
    12
    12
    14
    16
    11
    9
    1

    408
    R1b3-M269
    4
    14
    12
    24
    11
    13
    12
    13
    16
    13
    9
    1

    409
    R1b3-M269
    4
    14
    12
    24
    11
    13
    12
    13
    16
    11
    9
    1

    410
    R1b3-M269
    1
    14
    12
    24
    11
    13
    12
    13
    16
    13
    10
    1

    411
    R1b3-M269
    7
    14
    12
    24
    11
    13
    12
    14
    16
    11
    9
    1

    412
    R1b3-M269
    2
    14
    12
    24
    11
    13
    12
    13
    16
    13
    9
    1

    413
    R1b3-M269
    6
    14
    12
    24
    11
    13
    13
    14
    16
    11
    10
    1

    414
    R1b3-M269
    6
    14
    12
    24
    11
    13
    13
    14
    16
    11
    10
    1

    415
    R1b3-M269
    6
    14
    12
    24
    11
    13
    13
    13
    16
    12
    10
    1

    416
    R1b3-M269
    8
    14
    12
    24
    11
    13
    13
    13
    16
    12
    11
    1

    417
    R1b3-M269
    9
    14
    12
    24
    11
    13
    13
    13
    16
    11
    9
    1

    418
    R1b3-M269
    9
    14
    12
    24
    11
    13
    13
    13
    16
    12
    9
    1

    419
    R1b3-M269
    3
    14
    12
    24
    11
    13
    13
    13
    16
    12
    11
    1

    420
    R1b3-M269
    9
    14
    12
    24
    11
    13
    14
    12
    16
    11
    9
    1

    421
    R1b3-M269
    7
    14
    12
    24
    11
    13
    14
    13
    16
    12
    11
    1

    422
    R1b3-M269
    9
    14
    12
    24
    11
    14
    12
    13
    15
    13
    9
    1

    423
    R1b3-M269
    7
    14
    12
    24
    11
    14
    12
    13
    15
    13
    9
    1

    424
    R1b3-M269
    8
    14
    12
    24
    11
    15
    12
    13
    15
    13
    9
    1

    425
    R1b3-M269
    9
    14
    12
    24
    11
    15
    13
    13
    16
    12
    11
    1

    426
    R1b3-M269
    1
    14
    12
    24
    12
    13
    13
    13
    16
    12
    9
    1

    427
    R1b3-M269
    3
    14
    12
    25
    10
    13
    12
    13
    16
    13
    9
    1

    428
    R1b3-M269
    7
    14
    12
    25
    10
    13
    12
    13
    17
    12
    9
    1

    429
    R1b3-M269
    2
    14
    12
    25
    10
    13
    12
    14
    17
    12
    9
    1

    430
    R1b3-M269
    1
    14
    13
    23
    10
    13
    12
    14
    16
    11
    9
    1

    431
    R1b3-M269
    9
    14
    12
    25
    11
    13
    12
    13
    16
    12
    9
    1

    432
    R1b3-M269
    2
    14
    12
    25
    11
    13
    12
    12
    16
    13
    9
    1

    433
    R1b3-M269
    1
    14
    12
    25
    11
    14
    13
    13
    16
    11
    11
    1

    434
    R1b3-M269
    2
    14
    12
    24
    10
    13
    12
    13
    16
    13
    9
    1

    435
    R1b3-M269
    4
    14
    12
    24
    10
    13
    12
    13
    16
    12
    9
    1

    436
    R1b3-M269
    8
    14
    12
    21
    10
    13
    12
    13
    16
    12
    9
    1

    437
    R1b3-M269
    6
    15
    12
    25
    10
    12
    12
    14
    15
    11
    9
    1

    438
    R1b3-M269
    5
    15
    12
    24
    10
    13
    12
    12
    15
    11
    10
    1

    439
    R1b3-M269
    6
    15
    12
    24
    10
    13
    13
    12
    17
    13
    10
    1

    440
    R1b3-M269
    7
    15
    12
    23
    10
    14
    12
    12
    15
    12
    9
    1

    441
    R1b3-M269
    7
    15
    12
    21
    10
    13
    12
    13
    16
    12
    9
    1

    442
    R1b2-M73
    1
    14
    12
    19
    11
    13
    13
    13
    17
    12
    9
    1

    443
    R1b2-M73
    3
    14
    12
    19
    11
    13
    13
    14
    16
    12
    9
    1

    444
    R1b2-M73
    8
    14
    12
    25
    10
    13
    12
    13
    15
    11
    9
    1

    445
    R1b2-M73
    9
    15
    13
    24
    11
    11
    14
    13
    16
    12
    10
    1

    446
    R1b4-M335
    3
    15
    12
    25
    10
    13
    13
    14
    17
    12
    11
    1

    447
    R1c-M343
    3
    15
    12
    24
    10
    13
    13
    14
    17
    11
    10
    1

    448
    R2-M124
    1
    14
    11
    21
    10
    10
    14
    14
    16
    11
    11
    1

    449
    R2-M124
    7
    14
    13
    23
    10
    10
    14
    14
    17
    10
    10
    1

    450
    R2-M124
    5
    15
    12
    23
    10
    10
    14
    14
    16
    11
    10
    1

    451
    R2-M124
    2
    15
    12
    23
    10
    10
    14
    12
    16
    10
    9
    1

    452
    R2-M124
    5
    15
    12
    23
    10
    10
    14
    14
    16
    11
    10
    1


    Table B
    The distribution of Y-chromosome haplotypes affiliated with haplogroup R1b3-M269 in five regions of Europe (the populations are grouped as given in Fig. 3):Haplotype Number
    Haplogroup
    Population
    Allele status at
    Total

    DYS19
    DYS388
    DYS390
    DYS391
    DYS392
    DYS393
    DYS389I
    DYS389II
    DYS439
    DYSA7.2

    1
    R1b3-M269
    W. Europe, Iberia
    14
    12
    24
    11
    13
    13
    16
    13
    12
    10
    6

    2
    R1b3-M269
    W. Europe
    14
    12
    25
    11
    13
    13
    16
    13
    12
    10
    4

    3
    R1b3-M269
    W. Europe
    13
    12
    23
    10
    13
    13
    16
    13
    12
    10
    2

    4
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    14
    16
    13
    12
    10
    2

    5
    R1b3-M269
    W. Europe, Iberia
    15
    12
    24
    11
    13
    13
    16
    13
    12
    10
    2

    6
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    13
    16
    13
    11
    10
    1

    7
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    14
    13
    16
    13
    13
    10
    1

    8
    R1b3-M269
    W. Europe
    14
    12
    25
    11
    14
    13
    16
    13
    12
    11
    1

    9
    R1b3-M269
    W. Europe
    14
    13
    24
    11
    13
    13
    17
    13
    12
    10
    1

    10
    R1b3-M269
    Iberia
    14
    12
    24
    11
    13
    13
    16
    14
    11
    9
    1

    11
    R1b3-M269
    Iberia
    14
    12
    23
    10
    13
    13
    16
    14
    12
    10
    1

    12
    R1b3-M269
    Iberia
    14
    12
    23
    11
    13
    14
    16
    14
    13
    10
    1

    13
    R1b3-M269
    Iberia
    14
    12
    25
    10
    13
    12
    16
    13
    13
    10
    1

    14
    R1b3-M269
    Iberia
    14
    12
    23
    11
    13
    15
    15
    13
    11
    10
    1

    15
    R1b3-M269
    Iberia
    14
    12
    24
    11
    13
    13
    16
    14
    11
    10
    1

    16
    R1b3-M269
    Iberia
    14
    12
    24
    10
    13
    13
    16
    11
    12
    10
    1

    17
    R1b3-M269
    Iberia
    14
    12
    23
    10
    13
    13
    16
    13
    13
    10
    1

    18
    R1b3-M269
    Iberia
    14
    12
    24
    10
    13
    13
    15
    13
    11
    10
    1

    19
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    12
    17
    13
    13
    9
    1

    20
    R1b3-M269
    W. Europe
    14
    12
    23
    12
    13
    13
    16
    13
    11
    11
    1

    21
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    13
    16
    14
    12
    10
    1

    22
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    13
    16
    12
    12
    10
    1

    23
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    13
    12
    16
    13
    13
    10
    1

    24
    R1b3-M269
    W. Europe
    14
    12
    25
    12
    13
    13
    16
    14
    12
    10
    1

    25
    R1b3-M269
    W. Europe
    14
    12
    23
    11
    13
    13
    16
    14
    12
    10
    1

    26
    R1b3-M269
    Iberia
    14
    12
    24
    11
    13
    13
    17
    13
    12
    10
    1

    27
    R1b3-M269
    W. Europe
    14
    12
    25
    10
    13
    13
    16
    13
    12
    10
    1

    28
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    14
    16
    13
    13
    10
    1

    29
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    12
    16
    12
    13
    9
    1

    30
    R1b3-M269
    W. Europe
    14
    12
    25
    11
    13
    12
    17
    13
    12
    9
    1

    31
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    13
    13
    17
    13
    11
    10
    1

    32
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    13
    13
    16
    13
    13
    10
    1

    33
    R1b3-M269
    W. Europe
    14
    12
    25
    11
    12
    13
    16
    13
    12
    10
    1

    34
    R1b3-M269
    W. Europe
    14
    12
    23
    10
    13
    13
    16
    13
    12
    11
    1

    35
    R1b3-M269
    W. Europe
    14
    12
    24
    11
    13
    13
    16
    13
    13
    10
    1

    36
    R1b3-M269
    W. Europe
    14
    11
    24
    11
    13
    13
    16
    13
    12
    10
    1

    37
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    13
    13
    18
    13
    12
    9
    1

    38
    R1b3-M269
    W. Europe
    14
    12
    24
    10
    13
    13
    16
    13
    11
    10
    1

    39
    R1b3-M269
    W. Europe
    14
    12
    25
    10
    13
    13
    16
    13
    11
    10
    1

    40
    R1b3-M269
    W. Europe
    14
    12
    23
    11
    13
    13
    18
    13
    11
    10
    1

    41
    R1b3-M269
    W. Europe
    14
    12
    23
    11
    13
    13
    16
    13
    12
    10
    1

    42
    R1b3-M269
    W. Europe
    14
    12
    24
    12
    13
    13
    15
    13
    13
    10
    1

    43
    R1b3-M269
    Iberia
    15
    12
    23
    10
    13
    13
    16
    14
    13
    10
    1

    44
    R1b3-M269
    Iberia
    15
    12
    24
    10
    13
    13
    17
    14
    12
    10
    1

    45
    R1b3-M269
    W. Europe
    15
    12
    23
    11
    13
    13
    16
    14
    12
    11
    1

    46
    R1b3-M269
    W. Europe
    15
    12
    23
    10
    14
    12
    16
    14
    12
    10
    1

    47
    R1b3-M269
    W. Europe
    15
    12
    24
    10
    13
    13
    16
    14
    12
    10
    1

    48
    R1b3-M269
    W. Europe
    15
    12
    24
    11
    13
    13
    15
    13
    11
    11
    1

    49
    p49a,f-Ht35
    Balkan
    14
    12
    24
    11
    13
    13
    16
    13
    12
    9
    7

    50
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    13
    13
    16
    13
    12
    9
    2

    51
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    13
    12
    16
    13
    12
    9
    2

    52
    p49a,f-Ht35
    Turkey
    14
    12
    24
    11
    13
    12
    16
    13
    12
    9
    2

    53
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    11
    12
    16
    13
    13
    9
    1

    54
    p49a,f-Ht35
    Balkan
    14
    12
    24
    11
    13
    12
    16
    13
    12
    10
    1

    55
    p49a,f-Ht35
    Balkan
    14
    12
    24
    11
    13
    12
    17
    12
    12
    9
    1

    56
    p49a,f-Ht35
    Balkan
    14
    12
    25
    11
    13
    12
    16
    13
    11
    10
    1

    57
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    13
    12
    17
    13
    12
    9
    1

    58
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    13
    12
    17
    13
    11
    9
    1

    59
    p49a,f-Ht35
    Balkan
    14
    12
    23
    10
    13
    13
    16
    12
    11
    10
    1

    60
    p49a,f-Ht35
    Balkan
    14
    12
    24
    10
    13
    12
    17
    14
    13
    9
    1

    61
    p49a,f-Ht35
    Balkan
    14
    12
    23
    10
    13
    12
    17
    13
    13
    9
    1

    62
    p49a,f-Ht35
    Balkan
    15
    12
    24
    11
    13
    12
    15
    13
    13
    9
    1

    63
    p49a,f-Ht35
    Georgia
    14
    12
    23
    11
    13
    12
    16
    13
    12
    9
    1

    64
    p49a,f-Ht35
    Georgia
    15
    12
    24
    11
    13
    12
    17
    12
    12
    9
    1

    65
    p49a,f-Ht35
    Georgia
    14
    12
    23
    10
    13
    12
    16
    13
    12
    9
    1

    66
    p49a,f-Ht35
    Georgia
    14
    12
    22
    10
    13
    13
    17
    13
    12
    9
    1

    67
    p49a,f-Ht35
    Georgia
    14
    12
    24
    11
    13
    12
    16
    13
    11
    9
    1

    68
    p49a,f-Ht35
    Georgia
    14
    12
    23
    10
    13
    12
    17
    13
    12
    9
    1

    69
    p49a,f-Ht35
    Georgia
    14
    12
    24
    11
    14
    12
    16
    14
    11
    9
    1

    70
    p49a,f-Ht35
    Georgia
    14
    12
    24
    10
    13
    13
    16
    14
    12
    9
    1

    71
    p49a,f-Ht35
    Georgia
    14
    12
    23
    11
    13
    12
    17
    13
    11
    9
    1

    72
    p49a,f-Ht35
    Georgia
    14
    12
    24
    11
    13
    12
    17
    13
    12
    9
    1

    73
    p49a,f-Ht35
    Georgia
    14
    12
    24
    11
    13
    12
    16
    13
    11
    10
    1

    74
    p49a,f-Ht35
    Georgia
    14
    12
    23
    11
    13
    12
    16
    13
    12
    9
    1

    75
    p49a,f-Ht35
    Georgia
    14
    12
    25
    10
    13
    12
    17
    13
    12
    10
    1

    76
    p49a,f-Ht35
    Georgia
    14
    12
    24
    12
    13
    12
    16
    13
    11
    9
    1

    77
    p49a,f-Ht35
    Georgia
    14
    12
    24
    11
    11
    12
    16
    13
    12
    9
    1

    78
    p49a,f-Ht35
    Turkey
    14
    12
    23
    11
    13
    12
    17
    13
    12
    9
    1

    79
    p49a,f-Ht15
    Iberia
    14
    12
    24
    11
    13
    13
    16
    14
    11
    10
    2

    80
    p49a,f-Ht15
    W. Europe, Iberia
    14
    12
    24
    11
    13
    13
    16
    13
    12
    10
    2

    81
    p49a,f-Ht15
    Iberia
    14
    10
    24
    11
    13
    13
    16
    12
    11
    10
    1

    82
    p49a,f-Ht15
    Iberia
    14
    12
    24
    11
    13
    13
    17
    14
    12
    10
    1

    83
    p49a,f-Ht15
    Iberia
    14
    12
    24
    11
    13
    12
    16
    14
    12
    10
    1

    84
    p49a,f-Ht15
    Iberia
    14
    12
    24
    10
    13
    13
    16
    14
    11
    10
    1

    85
    p49a,f-Ht15
    Iberia
    14
    12
    24
    11
    13
    13
    16
    14
    12
    10
    1

    86
    p49a,f-Ht15
    W. Europe
    14
    12
    24
    10
    13
    13
    17
    13
    12
    10
    1

    87
    p49a,f-Ht15
    W. Europe
    14
    12
    25
    11
    13
    13
    18
    13
    12
    10
    1

    88
    p49a,f-Ht15
    W. Europe
    14
    12
    24
    10
    13
    13
    16
    13
    12
    10
    1

    89
    p49a,f-Ht15
    Iberia
    14
    13
    24
    11
    13
    13
    16
    14
    12
    10
    1

    Total












    111




    --------------------------------------------------------------------------------

    References
    Al-Zahery N, Semino O, Benuzzi G, Magri C, Passarino G, Torroni A, Santachiara-Benerecetti AS (2003) Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations. Mol Phylogenet Evol 28:458–472


    Ammerman AJ, Cavalli-Sforza LL (1984) The Neolithic Transition and the Genetics of Populations in Europe. Princeton University Press, Princeton, N.J.

    Ayub Q, Mohyuddin A, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler-Smith C (2000) Identification and characterisation of novel human Y-chromosomal microsatellites from sequence database information. Nucleic Acids Res 28:8


    Barac L, Pericic M, Klaric IM, Rootsi S, Janicijevi B, Kivisild T, Parik J, Rudan I, et al. (2003) Y chromosomal heritage of Croatian population and its island isolates. Eur J Hum Genet 11:535–542


    Bar-Yosef O (1998) The Natufian culture in the Levant, threshold to the origins of agriculture. Evol Anthropol6:159–177

    Blanco P, Shlumukova M, Sargent CA, Jobling MA, Affara N, Hurles ME (2000) Divergent outcomes of intrachromosomal recombination on the human Y chromosome: male infertility and recurrent polymorphism. J Med Genet 37:752–758


    Cavalli-Sforza LL, Menozzi P, Piazza A (1994) The history and geography of human genes. Princeton University Press, Princeton

    Cooper G, Amos W, Hoffman D, Rubinsztein DC (1996) Network analysis of human Y microsatellite haplotypes. Hum Mol Genet 5:1759–1766


    Cruciani F, Santolamazza P, Shen P, Macaulay V, Moral P, Olckers A, Modiano D, Destro-Bisol G, et al. (2002) An Asia to Sub-Saharan Africa back migration is supported by high-resolution analysis of human Y chromosome haplotypes. Am J Hum Genet 70:1197–1214


    de Knijff P (2000) Messages through bottlenecks: on the combined use of slow and fast evolving polymorphic markers on the human Y chromosome. Am J Hum Genet 67:1055–1061


    Di Benedetto G, Erguven A, Stenico M, Castri L, Bertorelle G, Togan I, Barbujani G (2001) DNA diversity and population admixture in Anatolia. Am J Phys Anthropol 115:144–156


    Di Giacomo F, Luca F, Anagnou N, Ciavarella G, Corbo RM, Cresta M, Cucci F, Di Stasi L, et al. (2003) Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects. Mol Phylogenet Evol 28:387–395


    Di Rienzo A, Peterson A, Garza J, Valdes A, Slatkin M, Freimer N (1994) Mutational processes of simple-sequence repeat loci in human populations. Proc Natl Acad Sci USA 91:3166–3170


    Hammer MF, Redd AJ, Wood ET, Bonner MR, Jarjanazi H, Karafet T, Santachiara-Benerecetti S, Oppenheim A, et al. (2000) Jewish and middle eastern non-Jewish populations share a common pool of Y-chromosome biallelic haplotypes. Proc Natl Acad Sci USA 97:6769–6774


    Hammer MF, Karafet TM, Redd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchical patterns of global human Y-chromosome diversity. Mol Biol Evol 18:1189–1203


    Jobling MA, Tyler-Smith C (2003) The human Y chromosome: an evolutionary marker comes of age. Nat Reviews Genet 4:598–612


    Karafet T, Xu L, Du R, Wang W, Feng S, Wells RS, Redd AJ, Zegura SL, et al. (2001) Paternal population history of East Asia: sources, patterns, and microevolutionary processes. Am J Hum Genet 69:615–628


    Kayser M, Caglia A, Corach D, Fretwell N, Gehrig C, Graziosi G, Heidorn F, Herrmann S, et al (1997) Evaluation of Y-chromosomal STRs: a multicenter study. Int J Legal Med 110:125–133


    Khazanov AM (1984) Nomads and the outside world. Cambridge, Cambridge University Press

    King R, Underhill PA (2002) Congruent distribution of Neolithic painted pottery and ceramic figurines with Y-chromosome lineages. Antiquity 76:707–714

    Kittles RA, Perola M, Peltonen L, Bergen AW, Aragon RA, Virkkunen M, Linnoila M, Goldman D, et al. (1998) Dual origins of Finns revealed by Y chromosome haplotype variation. Am J Hum Genet 62:1171–1179


    Kivisild T, Rootsi S, Metspalu M, Mastana S, Kaldma K, Parik J, Metspalu E, Adojaan M, et al. (2003) The genetic heritage of earliest settlers persist in both the Indian tribal and caste populations. Am J Hum Genet 72:313–332


    Knight A, Underhill PA, Zhivotovsky LA, Mortensen HM, Ruhlen M, Mountain JL (2003) African Y chromosome and mtDNA diversity and the antiquity of click languages. Curr Biol 13:464–473


    Korfmann M (1996) Troia — Ausgrabungen 1995. Studia Troica 6:1–64

    Kuhn SL (2002) Paleolithic archeology in Turkey. Evol Anthropol 11:198–210


    Malaspina P, Tsopanomichalou M, Duman T, Stefan M, Silvestri A, Rinaldi B, Garcia O, Giparaki M, et al. (2001) A multistep process for the dispersal of a Y chromosomal lineage in the Mediterranean area. Ann Hum Genet 65:339–349


    Manni F, Leonardi P, Barakat A, Rouba H, Heyer E, Klintschar M, McElreavey K, Quintana-Murci L (2002) Y-chromosome analysis in Egypt suggests a genetic regional continuity in northeastern Africa. Hum Biol 74:645–658


    Nasidze I, Sarkisian T, Kerimov A, Stoneking (2003) Testing hypotheses of language replacement in the Caucasus: evidence from the Y-chromosome. Hum Genet 112:255–261


    Nebel A, Filon D, Hohoff C, Faerman M, Brinkmann B, Oppenheim A (2001a) Haplogroup-specific deviation from the stepwise mutation model at the microsatellite loci DYS388 and DYS392. Eur J Hum Genet 9:22–26


    Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M, Oppenheim A (2001b) The Y chromosome pool of Jews as part of the genetic landscape of the Middle East. Am J Hum Genet 69:1095–1112


    Nebel A, Landau-Tasseron E, Filon D, Oppenheim A, Faerman M (2002) Genetic evidence for the expansion of Arabian tribes into the Southern Levant and North Africa. Am J Hum Genet 70:1594–1596


    Oefner PJ, Underhill PA (1998) DNA mutation detection using denaturing high performance liquid chromatography (DHPLC). Current protocols in human genetics, Suppl 19. Wiley, New York, pp 7.10.1–7.10.12

    Passarino G, Semino O, Magri C, Al-Zahery N, Benuzzi G, Quintana-Murci L, Andellnovic S, Bullc-Jakus F, et al. (2001) The 49a,f haplotype 11 is a new marker of the EU19 lineage that traces migrations from northern regions of the Black Sea. Hum Immunol 62:922–932


    Qamar R, Ayub Q, Mohyuddin A, Helgason A, Mazhar K, Mansoor A, Zerjal T, Tyler-Smith C, Mehdi SQ (2002) Y-chromosomal DNA variation in Pakistan. Am J Hum Genet 70:1107–1124


    Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Hammer MF, Mehdi SQ, Ayub Q, Qamar R, et al. (2001) Y-chromosome lineages trace diffusion of people and languages in southwestern Asia. Am J Hum Genet 68:537–542


    Raitio M, Lindroos K, Laukkanen M, Pastinen T, Sistonen P, Sajantila A, Syvänen A-C (2001) Y-chromosomal SNPs in Finno-Ugric speaking populations analyzed by minisequencing on microarrays. Genome Res 11:471–482


    Renfrew C (1998) Word of Minos: the Minoan contribution to Mycenaean Greek and the linguistic geography of the Bronze Age Aegean. Cambridge Archaeol J 8:239–264

    Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C, Sellitto D, et al. (2000) Tracing European founder lineages in the Near Eastern mtDNA pool. Am J Hum Genet 67:1251–1276


    Richards M, Macaulay V, Torroni A, Bandelt H-J (2002) In search of geographical patterns in European mitochondrial DNA. Am J Hum Genet 71:1168–1174


    Roberts N (2002) Did prehistoric landscape management retard the post-glacial spread of woodland Southwest Asia? Antiquity 76:1002–1010

    Rolf B, Meyer E, Brinkmann B, de Knijff P (1998) Polymorphism at the tetranucleotide repeat locus DYS389 in 10 populations reveals strong geographic clustering. Eur J Hum Genet 6:583–588


    Rolf B, Röhl A, Forster P, Brinkmann B (1999) On the genetic origins of the Turks study of six Y-chromosomal short tandem repeats. In: Papiha S, Deka R, Chakraborty R (eds) Genomic diversity: applications in human population genetics. Kluwer Academic/Plenum, New York, pp 75–82

    Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, Amorim A, Amos W, Armenteros M, et al. (2000) Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Am J Hum Genet 67:1526–1543


    Russell J (1958) Late ancient and medieval populations. Trans Am Philos Soc 48:81

    Santachiara Benerecetti AS, Semino O, Passarino G, Torroni A, Brdicka R, Fellous M, Modiano G (1993) The common, Near-Eastern origin of Ashkenazi and Sephardi Jews supported by Y-chromosome similarity. Ann Hum Genet 57:55–64


    Scozzari R, Cruciani F, Pangrazio A, Santolamazza P, Vona G, Moral P, Latini V, Varesi L, et al. (2001) Human Y-chromosome variation in the western Mediterranean area: implications for the peopling of the region. Hum Immunol 62:871–884


    Semino O, Passarino G, Brega A, Fellous M, Santachiara-Benerecetti AS (1996) A view of the Neolithic demic-diffusion in Europe through two Y chromosome-specific markers. Am J Hum Genet 9:964–968

    Semino O, Passarino G, Oefner PJ, Lin AA, Arbuzova S, Beckman LE, De Benedictis G, Francalacci, et al. (2000a) The genetic legacy of Palaeolithic Homo sapiens in extant Europeans: a Y-chromosome perspective. Science 290:1155–1159


    Semino O, Passarino G, Quintana-Murci L, Liu A, Beres J, Czeizel A, Santachiara-Benerecetti AS (2000b) MtDNA and Y chromosome polymorphisms in Hungary: inferences from the palaeolithic, neolithic and Uralic influences on the modern Hungarian gene pool. Eur J Hum Genet 8:339–346


    Shen P, Wang F, Underhill PA, Franco C, Yang W-H, Roxas A, Sung R, Lin AA, et al. (2000) Population genetic implications from sequence variation in four Y chromosome genes. Proc Natl Acad USA 97:7354–7359


    Su B, Xiao C, Deka R, Seielstad MT, Kangwanpong D, Xiao J, Lu D, Underhill, PA, et al. (2000) Y chromosome haplotypes reveal prehistoric migrations to the Himalayas. Hum Genet 107:582–590


    Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R, Page DC (2000) Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genetics 9:2291–2296


    Thissen L (1999) Trajectories towards the neolithisation of NW Turkey. Documenta Praehistorica 26:29–39

    Thomas MG, Parfitt T, Weiss DA, Skorecki K, Wilson JF, le Roux M, Bradman N, Goldstein D (2000) Y chromosomes traveling south: the Cohen modal haplotype and the origins of the Lemba-the black Jews of Southern Africa. Am J Hum Genet 66:674–686

    Torroni A, Semino O, Scozzari R, Sirugo G, Spedini G, Abbas N, Fellous M, Santachiara Benerecetti AS (1990) Y chromosome DNA polymorphisms in human populations: differences between Caucasoids and Africans detected by 49a and 49f probes. Ann Hum Genet 54:287–296


    Torroni A, Bandelt HJ, DUrbano L, Lahermo P, Moral P, Sellitto D, Rengo C, Forster P, et al. (1998) mtDNA analysis reveals a major late Paleolithic population expansion from southwestern to northeastern Europe. Am J Hum Genet 62:1137–1152


    Underhill PA (2002) Inference of Neolithic population histories using Y-chromosome haplotypes. In: Bellwood P, Renfrew P (eds) Examining the farming/language dispersal hypothesis. McDonald Institute for Archaeological Research, Cambridge, pp 65–78

    Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonné-Tamir B, et al. (2000) Y chromosome sequence variation and the history of human populations. Nat Genet 26:358–361


    Underhill PA, Passarino G, Lin AA, Shen P, Foley RA, Mirazón Lahr M, Oefner PJ Cavalli-Sforza LL (2001) The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann. Hum Genet 65:43–62


    Weale ME, Yepiskoposyan L, Jager RF, Hovhannisyan N, Khudoyan A, Burbage-Hall O, Bradman N, Thomas MG (2001) Armenian Y chromosome haplotypes reveal strong regional structure within a single ethno-national group. Hum Genet 109:659–674


    Wells RS, Yuldasheva N, Ruzibakiev R, Underhill PA, Evseeva I, Blue-Smith J, Jin L, Su B, et al. (2001) The Eurasian heartland: a continental perspective on Y-chromosome diversity. Proc Natl Acad Sci USA 98:10244–10249


    White PS, Tatum OL, Deaven LL, Longmire JL (1999) New, male-specific microsatellite markers from the human Y chromosome. Genomics 57:433–437


    Wilson I, Weale M, Balding D (1998) Genealogical inference from microsatellite data. Genetics 150:499–510


    Wilson JF, Weiss DA, Richards M, Thomas MG, Bradman N, Goldstein DB (2001) Genetic evidence for different male and female roles during cultural transitions in the British Isles. Proc Natl Acad Sci USA 98:5078–5083


    Y Chromosome Consortium (2002) A nomenclature system for the tree of human Y-chromosomal binary haplogroups. Genome Res 12:339–348


    Zerjal T, Xue Y, Bertorelle G, Wells RS, Bao W, Zhu S, Qamar R, Ayub Q, et al. (2003) The genetic legacy of the Mongols. Am J Hum Genet 72:717–721


    Zhivotovsky LA, Rosenberg NA, Feldman MW (2003) Features of evolution and expansion of modern humans, inferred from genomewide microsatellite markers. Am J Hum Genet 72:1171–1186

  2. #2
    Member
    Join Date
    Aug 2007
    Last Online
    Saturday, April 28th, 2018 @ 05:23 AM
    Ethnicity
    Katarinensische
    Subrace
    Dinarid
    Gender
    Age
    42
    Family
    Single adult
    Posts
    1,243
    Thanks Thanks Given 
    0
    Thanks Thanks Received 
    1
    Thanked in
    1 Post

    Post Re: Y-chromosome haplotype strata in Anatolia ( full Article)

    ------------------------ Pdf ------------------------------

Similar Threads

  1. Replies: 0
    Last Post: Wednesday, September 23rd, 2009, 04:56 PM
  2. Replies: 0
    Last Post: Wednesday, April 12th, 2006, 10:53 PM
  3. Haplotype frequencies of eight Y-chromosome STR loci in Barcelona
    By Euclides in forum Y-Chromosome (Y-DNA) Haplogroups
    Replies: 0
    Last Post: Wednesday, June 30th, 2004, 11:35 PM
  4. Dual origins of Finns revealed by Y chromosome haplotype variation.
    By Euclides in forum Y-Chromosome (Y-DNA) Haplogroups
    Replies: 0
    Last Post: Sunday, June 27th, 2004, 06:12 PM
  5. Y-chromosome STR haplotype in Szekely population
    By Euclides in forum Y-Chromosome (Y-DNA) Haplogroups
    Replies: 2
    Last Post: Wednesday, June 2nd, 2004, 10:42 PM

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •